Previous Contig 009825:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017A21Sequence585001533 (5)gb:OSJN00138_16955213e-50Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30, complete sequenc788009825 (5)gb:AF428364_17992945e-60Arabidopsis thaliana At2g43320/T1O24.6 mRNA, complete cds.
JMFF034I09Sequence551001533 (5)gb:OSJN00138_16955214e-29Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30, complete sequenc744009825 (5)gb:AF428364_17992947e-49Arabidopsis thaliana At2g43320/T1O24.6 mRNA, complete cds.
JMSF021H16Sequence663001533 (5)gb:OSJN00138_16955212e-51Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30, complete sequenc742009825 (5)gb:AF428364_17992944e-61Arabidopsis thaliana At2g43320/T1O24.6 mRNA, complete cds.
JMSF028E21Sequence554001533 (5)gb:OSJN00138_16955211e-32Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30, complete sequenc715009825 (5)gb:AF428364_17992943e-52Arabidopsis thaliana At2g43320/T1O24.6 mRNA, complete cds.
JMSF042I17Sequence720001533 (5)gb:OSJN00138_16955211e-52Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30, complete sequenc746009825 (5)gb:AF428364_17992941e-61Arabidopsis thaliana At2g43320/T1O24.6 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF021H16+ GAACGG
rJMSF042I17+ GAACGG
rJMFF017A21+ GGCTCGGGAACGG
                      ____________________________________________________________
consensus GGCTCGGGAACGG
 
. : . : . : . : . : . :
rJMSF021H16+ CAGTGCCGTCAACCTGAGAGCCCTTTGACTCCTTCTAGGCAGACTCTTGCTCCAACAGTA
rJMSF042I17+ CAGTGCCGTCAACCTGAGAGCCCTTTGACTCCTTCTAGGCAGACTCTTGCTCCAACAGTA
rJMSF028E21+ CTAGGCAGACTC-TGCTCCANCAGTA
rJMFF017A21+ CAGTGCCGTCAACNTGAGAGCCCTTTGACTCNTTCTAGGCAGACTCTTGCTCCAACAGTA
rJMFF034I09+ AGGCAGACTCTTGCTCCAACAGTA
                      ____________________________________________________________
consensus CAGTGCCGTCAACCTGAGAGCCCTTTGACTCCTTCTAGGCAGACTCTTGCTCCAACAGTA
 
. : . : . : . : . : . :
rJMSF021H16+ AACTTTTATGCAGGGGAAT-GGGGGGAACTGCCAACGGTGTTGTCTGTTGTTAGGAATGA
rJMSF042I17+ AACTTTTATGCAGGGGAAT-GGGGGGAACTGCCAACGGTGTTGTCTGTTGTTAGGAATGA
rJMSF028E21+ AACTTTTATGCAGGGGAAT-GGGGGGAACTGCCAACGGTGTTGTCTGTTGTTAGGAATGA
rJMFF017A21+ AACTTTTATGCAGGGGAAT-GGGGGGAACTGCCAACGGTGTTGTCTGTTGTTAGGAATGA
rJMFF034I09+ AACTTTTATGCAGGGGAATGGGGGGGAACTGCCAACGGTGTTGTCTGTTGTTAGGAATGA
                      ____________________________________________________________
consensus AACTTTTATGCAGGGGAAT-GGGGGGAACTGCCAACGGTGTTGTCTGTTGTTAGGAATGA
 
. : . : . : . : . : . :
rJMSF021H16+ TGCATCTGAGATACCTAGAGGGATGAGCCTCAGCTTCTCTGAGGAAGATTTAATGGATGG
rJMSF042I17+ TGCATCTGAGATACCTAGAGGGATGAGCCTCAGCTTCTCTGAGGAAGATTTAATGGATGG
rJMSF028E21+ TGCATCTGAGATACCTAGAGGGATGAGCCTCAGCTTCTCTGAGGAAGATTTAATGGATGG
rJMFF017A21+ TGCATCTGAGATACCTAGAGGGATGAGCCTCAGCTTCTCTGAGGAAGATTTAATGGATGG
rJMFF034I09+ TGCATCTGAGATACCTAGAGGGATGAGCNTCAGCTTCTCTGAGGAAGATTTAATGGATGG
                      ____________________________________________________________
consensus TGCATCTGAGATACCTAGAGGGATGAGCCTCAGCTTCTCTGAGGAAGATTTAATGGATGG
 
. : . : . : . : . : . :
rJMSF021H16+ CTGTAGTAGCCAAGATGGGAGCATCTTAGTCCATGAATCTTCCTCGAGGCGGTCTAGGAA
rJMSF042I17+ CTGTAGTAGCCAAGATGGGAGCATCTTAGTCCATGAATCTTCCTCGAGGCGGTCTAGGAA
rJMSF028E21+ CTGTAGTAGCCAAGATGGGAGCATCTTAGTCCATGAATCTTCCTCGAGGCGGTCTAGGAA
rJMFF017A21+ CTGTAGTAGCCAAGATGGGAGCATCTTAGTCCATGAATCTTCCTCGAGGCGGTCTAGGAA
rJMFF034I09+ CTGTAGTAGCCAAGATGGGAGCATCTTAGTCCATGAATCTTCCTCGAGGCGGTCTAGGAA
                      ____________________________________________________________
consensus CTGTAGTAGCCAAGATGGGAGCATCTTAGTCCATGAATCTTCCTCGAGGCGGTCTAGGAA
 
. : . : . : . : . : . :
rJMSF021H16+ ACTGTCTGGAAGCAGGGCATGGGAGAGGGCTAGTGATGCAGACCAAGGAGAAAGTGGGTA
rJMSF042I17+ ACTGTCTGGAAGCAGGGCATGGGAGAGGGCTAGTGATGCAGACCAAGGAGAAAGTGGGTA
rJMSF028E21+ ACTGTCTGGAAGCAGGGCATGGGAGAGGGCTAGTGATGCAGACCAAGGAGAAAGTGGGTA
rJMFF017A21+ ACTGTCTGGAAGCAGGGCATGGGAGAGGGCTAGTGATGCAGACCAAGGAGAAAGTGGGTA
rJMFF034I09+ ACTGTCTGGAAGCAGGGCATGGGAGAGGGCTAGTGATGCAGACCAAGGAGAAAGTGGGTA
                      ____________________________________________________________
consensus ACTGTCTGGAAGCAGGGCATGGGAGAGGGCTAGTGATGCAGACCAAGGAGAAAGTGGGTA
 
. : . : . : . : . : . :
rJMSF021H16+ TGATGTTATTTTGATGACCGAGATTCCCTATTCAGTGGCCTCACTGAAGAAGCTGTATTC
rJMSF042I17+ TGATGTTATTTTGATGACCGAGATTCCCTATTCAGTGGCCTCACTGAAGAAGCTGTATTC
rJMSF028E21+ TGATGTTATTTTGATGACCGAGATTCCCTATTCAGTGGCCTCACTGAAGAAGCTGTATTC
rJMFF017A21+ TGATGTTATTTTGATGACCGAGATTCCCTATTCAGTGGCCTCACTGAAGAAGCTGTATTC
rJMFF034I09+ TGATGTTATTTTGATGACCGAGATTCCCTATTCAGTGGCCTCACTGAAGAAGCTGTATTC
                      ____________________________________________________________
consensus TGATGTTATTTTGATGACCGAGATTCCCTATTCAGTGGCCTCACTGAAGAAGCTGTATTC
 
. : . : . : . : . : . :
rJMSF021H16+ ACTGATAAAAAAGTGCTTAAGGCCCCCTTATGGAGTAATGTACCTGGCAACAAAAAGAAA
rJMSF042I17+ ACTGATAAAAAAGTGCTTAAGGCCCCCTTATGGAGTAATGTACCTGGCAACAAAAAGAAA
rJMSF028E21+ ACTGATAAAAAAGTGCTTAAGGCCCCCTTATGGAGTAATGTACCTGGCAACAAAAAGAAA
rJMFF017A21+ ACTGATAAAAAAGTGCTTAAGGCCCCCTTATGGAGTAATGTACCTGGCAACAAAAAGAAA
rJMFF034I09+ ACTGATAAAAAAGTGCTTAAGGCCCCCTTATGGAGTAATGTACCTGGCAACAAAAAGAAA
                      ____________________________________________________________
consensus ACTGATAAAAAAGTGCTTAAGGCCCCCTTATGGAGTAATGTACCTGGCAACAAAAAGAAA
 
. : . : . : . : . : . :
rJMSF021H16+ CTATGTTGGCTTCAACAGTGCTGCACGACACCTCCGGAGTCTGGTGGATGAGGAAGGTGT
rJMSF042I17+ CTATGTTGGCTTCAACAGTGCTGCACGACACCTCCGGAGTCTGGTGGATGAGGAAGGTGT
rJMSF028E21+ CTATGTTGGCTTCAACAGTGCTGCACGACACCTCCGGAGTCTGGTGGATGAGGAAGGTGT
rJMFF017A21+ CTATGTTGGCTTCAACAGCGCTGCACGACACCTCCGGAGTCTGGTGGATGAGGAAGGTGT
rJMFF034I09+ CTATGTTGGCTTCAACAGTGCTGCACGACACCTCCGGAGTCTGGTGGATGAGGAAGGTGT
                      ____________________________________________________________
consensus CTATGTTGGCTTCAACAGTGCTGCACGACACCTCCGGAGTCTGGTGGATGAGGAAGGTGT
 
. : . : . : . : . : . :
rJMSF021H16+ TTTTGGTGCTCATTTGGTAACAGAGCTAACAGACAGAGAGATTTGGAAATTCTTTTTCAA
rJMSF042I17+ TTTTGGTGCTCATTTGGTAACAGAGCTAACAGACAGAGAGATTTGGAAATTCTTTTTCAA
rJMSF028E21+ TTTTGGTGCTCATTTGGTAACAGAGCTAACAGACAGAGAGATTTGGAAATTCTTTTTCAA
rJMFF017A21+ TTTTGGTGCTCATTTGGTAACAGAGCTAACAGACAGAGAGATTTGGAAATTCTTTTTCAA
rJMFF034I09+ TTTTGGTGCTCATTTGGTAACAGAGCTAACAGACAGAGAGATTTGGAAATTCTTTTTCAA
                      ____________________________________________________________
consensus TTTTGGTGCTCATTTGGTAACAGAGCTAACAGACAGAGAGATTTGGAAATTCTTTTTCAA
 
. : . : . : . : . : . :
rJMSF021H16+ ATGAAAAGATGATCTCAGCTTTGCCCCAAAGGTTCTATTCATTCAATAATTGTTTCCAGT
rJMSF042I17+ ATGAAAAGATGATCTCAGCTTTGCCCCAAAGGTTCTATTCATTCAATAATTGTTTCCAGT
rJMSF028E21+ ATGAAAAGATGATCTCAGCTTTGCCCCAAAGGTTCTATTCATTCAATAATTGTTTCCAGT
rJMFF017A21+ ATGAAAAGATGATCTCAGCTTTGCCCCAAAGGTTCTATTCATTCAATAATTGTTTCCAGT
rJMFF034I09+ ATGAAAAGATGATCTCAGCTTTGCCCCAAAGGTTCTATTCATTCAATAATTGTTTCCAGT
                      ____________________________________________________________
consensus ATGAAAAGATGATCTCAGCTTTGCCCCAAAGGTTCTATTCATTCAATAATTGTTTCCAGT
 
. : . : . : . : . : . :
rJMSF021H16+ AATATTATAATATAATAGTAAATTCTTAGCTTGTTATTAAGAAAAGATACACTACTGGAT
rJMSF042I17+ AATATTATAATATAATAGTAAATTCTTAGCTTGTTATTAAGAAAAGATACACTACTGGAT
rJMSF028E21+ AATATTATAATATAATAGTAAATTCTTAGCTTGTTATTAAGAAAAGATACACTACTGGAT
rJMFF017A21+ AATATTATAATATAATAGTAAATTCTTAGCTTGTTATTAAGAAAAGATACACTACTGGAT
rJMFF034I09+ AATATTATAATATAATAGTAAATTCTTAGCTTGTTATTAAGAAAAGATACACTACTGGAT
                      ____________________________________________________________
consensus AATATTATAATATAATAGTAAATTCTTAGCTTGTTATTAAGAAAAGATACACTACTGGAT
 
. : . : . : . : . : . :
rJMSF021H16+ GGTTCAGTGCTTGTCTCCTGTAATTATGTTCTTTAAACTTGTTGTTTACGTTGAGAGAGA
rJMSF042I17+ GGTTCAGTGCTTGTCTCCTGTAATTATGTTCTTTAAACTTGTTGTTTACGTTGAGAGAGA
rJMSF028E21+ GGTTCAGTGCTTGTCTCCTGTAATTATGTTCTTTAAACTTGTTGTTTACGTTGAGAGAGA
rJMFF017A21+ GGTTCAGTGCTTGTCTCCTGTAATTATGTTCTTTAAACTTGTTGTTTACGTTGAGAGAGA
rJMFF034I09+ GGTTCAGTGCTTGTCTCCTGTAATTATGTTCTTTAAACTTGTTGTTTACGTTGAGAGAGA
                      ____________________________________________________________
consensus GGTTCAGTGCTTGTCTCCTGTAATTATGTTCTTTAAACTTGTTGTTTACGTTGAGAGAGA
 
. : . : . : . : . : . :
rJMSF021H16+ TGTAAATTTTATAGGCT
rJMSF042I17+ TGTAAATTTTATAGGC
rJMSF028E21+ TGTAAATTTTATAGGCTTGTGTAATATACTT
rJMFF017A21+ TGTAAATTTTATAGGCTTGTGTAATATACTTTGTTTTAGCATTGATGGAGGAGGAA
rJMFF034I09+ TGTAAATTTTATAGGCTTGTGTAATATACTTTGTTTTAGCATTGATGGAGGAGGAAAATC
                      ____________________________________________________________
consensus TGTAAATTTTATAGGCTTGTGTAATATACTTTGTTTTAGCATTGATGGAGGAGGAAAATC