Previous Contig 009823:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024A10Sequence491009823 (8)pir|B86307|B863079e-28F20D23.18 protein - Arabidopsis thaliana>gb:AE005172_890687 Arabidopsis thaliana811009823 (8)pir|B86307|B863078e-30F20D23.18 protein - Arabidopsis thaliana>gb:AE005172_890687 Arabidopsis thaliana
JMFF034H12Sequence507009823 (8)pir|B86307|B863075e-27F20D23.18 protein - Arabidopsis thaliana>gb:AE005172_890687 Arabidopsis thaliana716009823 (8)pir|B86307|B863070.011F20D23.18 protein - Arabidopsis thaliana>gb:AE005172_890687 Arabidopsis thaliana
JMFF039M20Sequence494009823 (8)pir|B86307|B863079e-28F20D23.18 protein - Arabidopsis thaliana>gb:AE005172_890687 Arabidopsis thaliana809009823 (8)pir|B86307|B863071e-23F20D23.18 protein - Arabidopsis thaliana>gb:AE005172_890687 Arabidopsis thaliana
JMSF035F18Sequence650009823 (8)pir|B86307|B863071e-70F20D23.18 protein - Arabidopsis thaliana>gb:AE005172_890687 Arabidopsis thaliana716009823 (8)pir|B86307|B863070.011F20D23.18 protein - Arabidopsis thaliana>gb:AE005172_890687 Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF034H12- AATACAACCAATAACGGTTGTCGTACTAA
JMFF024A10- GTCGTACTAA
JMFF039M20- GTCGTACTAA
                      ____________________________________________________________
consensus AATACAACCAATAACGGTTGTCGTACTAA
 
. : . : . : . : . : . :
JMFF034H12- GCCCCTCAACCCTTTCCAGGCTTCCCTAATTCCTCTCGGCCTCATTCTCTTCTTCTCCAA
JMFF024A10- GCCCCTCAACCCTTTCCAGGCTTCCCTAATTCCTCTCGGCCTCATTCTCTTCTTCTCCAA
JMFF039M20- GCCCCTCAACCCTTTCCAGGCTTCCCTAATTCCTCTCGGCCTCATTCTCTTCTTCTCCAA
                      ____________________________________________________________
consensus GCCCCTCAACCCTTTCCAGGCTTCCCTAATTCCTCTCGGCCTCATTCTCTTCTTCTCCAA
 
. : . : . : . : . : . :
JMFF034H12- ATTTCCAATCTTCACGAGACCACAGCCGACTCCAATCTCCGACGCCCTCCATCCAAATCT
JMFF024A10- ATTTCCAATCTTCACGAGACCACAGCCGACTCCAATCTCCGACGCCCTCCATCCAAATCT
JMFF039M20- ATTTCCAATCTTCACGAGACCACAGCCGACTCCAATCTCCGACGCCCTCCATCCAAATCT
                      ____________________________________________________________
consensus ATTTCCAATCTTCACGAGACCACAGCCGACTCCAATCTCCGACGCCCTCCATCCAAATCT
 
. : . : . : . : . : . :
JMFF034H12- TCCTCTCACGCCCTCCGGCTGTCCGGCCGACGCCCTCGCTGCTCAAGGAGTCAAGGAGAC
JMFF024A10- TCCTCTCACGCCCTCCGGCTGTCCGGCCGACGCCCTCGCTGCTCAAGGAGTCAAGGAGAC
JMFF039M20- TCCTCTCACGCCCTCCGGCTGTCCGGCCGACGCCCTCGCTGCTCAAGGAGTCAAGGAGAC
                      ____________________________________________________________
consensus TCCTCTCACGCCCTCCGGCTGTCCGGCCGACGCCCTCGCTGCTCAAGGAGTCAAGGAGAC
 
. : . : . : . : . : . :
JMFF034H12- AAGTAGGAACTTGCTCGATAAGGACTTTTCTGTTTTGTTTGGAAGTATTTTGAGCTGGTG
JMFF024A10- AAGTAGGAACTTGCTCGATAAGGACTTTTCTGTTTTGTTTGGAAGTATTTTGAGCTGGTG
JMFF039M20- AAGTAGGAACTTGCTCGATAAGGACTTTTCTGTTTTGTTTGGAAGTATTTTGAGCTGGTG
                      ____________________________________________________________
consensus AAGTAGGAACTTGCTCGATAAGGACTTTTCTGTTTTGTTTGGAAGTATTTTGAGCTGGTG
 
. : . : . : . : . : . :
JMFF034H12- TTTACTAAATTCCGTTTGATTTGATCCGATTGAGAGGGAGGACTGATAAGCCACCATGGG
JMFF024A10- TTTACTAAATTCCGTTTGATTTGATCCGATTGAGAGGGAGGACTGATAAGCCACCATGGG
JMFF039M20- TTTACTAAATTCCGTTTGATTTGATCCGATTGAGAGGGAGGACTGATAAGCCACCATGGG
JMSF035F18- AGAGGGAGGACTGATAAGCCACCATGGG
                      ____________________________________________________________
consensus TTTACTAAATTCCGTTTGATTTGATCCGATTGAGAGGGAGGACTGATAAGCCACCATGGG
 
. : . : . : . : . : . :
JMFF034H12- AGAGAGAAAGGTTTTGAACAAGTACTATCCGCCGGATTTCGATCCGGCGAAGATACCGCG
JMFF024A10- AGAGAGAAAGGTTTTGAACAAGTACTATCCGCCGGATTTCGATCCGGCGAAGATACCGCG
JMFF039M20- AGAGAGAAAGGTTTTGAACAAGTACTATCCGCCGGATTTCGATCCGGCGAAGATACCGCG
JMSF035F18- AGAGAGAAAGGTTTTGAACAAGTACTATCCGCCGGATTTCGATCCGGCGAAGATACCGCG
                      ____________________________________________________________
consensus AGAGAGAAAGGTTTTGAACAAGTACTATCCGCCGGATTTCGATCCGGCGAAGATACCGCG
 
. : . : . : . : . : . :
JMFF034H12- CCGGAGGCAGCCGAAGAACCAGCAAATGAAGGTTCGAATGATGCTTCCAATGAGCGTTAG
JMFF024A10- CCGGAGGCAGCCGAAGAACCAGCAAATGAAGGTTCGAATGATGCTTCCAATGAGCGTTAG
JMFF039M20- CCGGAGGCAGCCGAAGAACCAGCAAATGAAGGTTCGAATGATGCTTCCAATGAGCGTTAG
JMSF035F18- CCGGAGGCAGCCGAAGAACCAGCAAATGAAGGTTCGAATGATGCTTCCAATGAGCGTTAG
                      ____________________________________________________________
consensus CCGGAGGCAGCCGAAGAACCAGCAAATGAAGGTTCGAATGATGCTTCCAATGAGCGTTAG
 
. : . : . : . : . : . :
JMFF034H12- ATGCAATACCTGCGGGAACTATATCTACAAGGGCACCAAATTCAACTCCCGCAAAGAA
JMFF024A10- ATGCAATACCTGCGGGAACTATATCTACAAGGGCACCAAATTCAACTCCCGCAAAGAA
JMFF039M20- ATGCAATACCTGCGGGAACTATATCTACAAGGGCACCAAATTCAACTCCCGCAAAGAA
JMSF035F18- ATGCAATACCTGCGGGAACTATATCTACAAGGGCACCAAATTCAACTCCCGCAAAGAAGA
                      ____________________________________________________________
consensus ATGCAATACCTGCGGGAACTATATCTACAAGGGCACCAAATTCAACTCCCGCAAAGAAGA
 
. : . : . : . : . : . :
JMSF035F18- CGCCGTAGGCGAGAACTATTTGGGTATTCAAATATTCAGATTCTACTTCAAGTGCACAAA
                      ____________________________________________________________
consensus CGCCGTAGGCGAGAACTATTTGGGTATTCAAATATTCAGATTCTACTTCAAGTGCACAAA
 
. : . : . : . : . : . :
JMSF035F18- GTGCTCTGCAGAGATCACGTACAAAACGGATCCAAAAAATTCTGATTATATTGTTGAGTC
                      ____________________________________________________________
consensus GTGCTCTGCAGAGATCACGTACAAAACGGATCCAAAAAATTCTGATTATATTGTTGAGTC
 
. : . : . : . : . : . :
JMSF035F18- GGGTGCAACAAGGAATTTTGAACCTTGGCGTGAACAAGATGAGGAAATTGAGAAACTGAA
                      ____________________________________________________________
consensus GGGTGCAACAAGGAATTTTGAACCTTGGCGTGAACAAGATGAGGAAATTGAGAAACTGAA
 
. : . : . : . : . : . :
JMSF035F18- ACAGAAAAGAGATGCTGAAGAAATGGGTGATGCTATGAGGTCATTGGAAAATAGGACGTT
rJMFF024A10+ AGAGATGCTGAAGAAATGGGTGATGCTATGAAGTCATTGGAAAATAGGACGTN
rJMFF039M20+ AGAGATGCTGAAGAAATGGGTGATGCTATGAAGTCATTGGAAAATAGGACGTG
                      ____________________________________________________________
consensus ACAGAAAAGAGATGCTGAAGAAATGGGTGATGCTATGAAGTCATTGGAAAATAGGACGTT
 
. : . : . : . : . : . :
JMSF035F18- GGAT
rJMFF024A10+ GGATTCAAAAAGAGAAATGGATATTCTTGCTGCTTTGGATGAAATGAAAT-CCATGAAGT
rJMFF039M20+ GGATTCAAAAAGAGAAATGGATATTCTTGCTGCTTTGGATGAAATGAAATCCCATGAAGT
                      ____________________________________________________________
consensus GGATTCAAAAAGAGAAATGGATATTCTTGCTGCTTTGGATGAAATGAAATCCCATGAAGT
 
. : . : . : . : . : . :
rJMFF024A10+ CAAGACAAGCAACCGTGAGTGTGGAAGCAATGCTTGAGGCTCTTACACACTCTGCTGAGG
rJMFF039M20+ CAAGACAAGCAACCGTGAGTGTGGAAGCAATGCTTGAGGCTCTTACACACTCTGCTGAGG
                      ____________________________________________________________
consensus CAAGACAAGCAACCGTGAGTGTGGAAGCAATGCTTGAGGCTCTTACACACTCTGCTGAGG
 
. : . : . : . : . : . :
rJMFF024A10+ AAAAGGAAAGGAAAATGCTGGAAGAAGAGGAAGCTCTTATTAAATCTTTATTCAAAGGAG
rJMFF039M20+ AAAAGGAAAGGAAAATGCTGGAAGAAGAGGAAGCTCTTATTAAATCTTTATTCAAAGGAG
rJMSF035F18+ AAGGAG
                      ____________________________________________________________
consensus AAAAGGAAAGGAAAATGCTGGAAGAAGAGGAAGCTCTTATTAAATCTTTATTCAAAGGAG
 
. : . : . : . : . : . :
rJMFF024A10+ AGCGAGAGAAGTTTGTAAAAAGAATCCGTGATGATGAAATTGAAGATGACGATGATGATG
rJMFF039M20+ AGCGAGAGAAGTTTGTAAAAAGAATCCGTGATGATGAAATTGAAGATGACGATGATGATG
rJMSF035F18+ AGCGAGAGAAGTTTGTAAAAAGAATCCGTGATGATGAAATTGAAGATGACGATGATGATG
rJMFF034H12+ AGAGAAGTTTGTAAAAAGAATCCGTGATGATGAAATTGAAGATGACGATGATGATG
                      ____________________________________________________________
consensus AGCGAGAGAAGTTTGTAAAAAGAATCCGTGATGATGAAATTGAAGATGACGATGATGATG
 
. : . : . : . : . : . :
rJMFF024A10+ AAGAAGATTTGGATATACCACAAAAGAGTGGAGAATCATCAACCAATTCTGTTAAGAGGA
rJMFF039M20+ AAGAAGATTTGGATATACCACAAAAGAGTGGAGAATCATCAACCAATTCTGTTAAGAGGA
rJMSF035F18+ AAGAAGATTTGGATATACCACAAAAGAGTGGAGAATCATCAACCAATTCTGTTAAGAGGA
rJMFF034H12+ AAGAAGATTTGGATATACCACAAAAGAGTGGAGAATCATCAACCAATTCTGTTAAGAGGA
                      ____________________________________________________________
consensus AAGAAGATTTGGATATACCACAAAAGAGTGGAGAATCATCAACCAATTCTGTTAAGAGGA
 
. : . : . : . : . : . :
rJMFF024A10+ GAAAGCTACCTGAGGAACTATGTAGTAACCCTACAGATGTCTTGACAAAATCCAATGCCA
rJMFF039M20+ GAAAGCTACCTGAGGAACTATGTAGTAACCCTACAGATGTCTTGACAAAATCCAATGCCA
rJMSF035F18+ GAAAGCTACCTGAGGAACTATGTAGTAACCCTACAGATGTCTTGACAAAATCCAATGCCA
rJMFF034H12+ GAAAGCTACCTGAGGAACTATGTAGTAACCCTACAGATGTCTTGACAAAATCCAATGCCA
                      ____________________________________________________________
consensus GAAAGCTACCTGAGGAACTATGTAGTAACCCTACAGATGTCTTGACAAAATCCAATGCCA
 
. : . : . : . : . : . :
rJMFF024A10+ CTGACAACTCTAGTGACAAAGATAAAGCGGCGGGGAAGAGGGATTCTGGTAATGAAAAAT
rJMFF039M20+ CTGACAACTCTAGTGACAAAGATAAAGCGGCGGGGAAGAGGGATTCTGGTAATGAAAAAT
rJMSF035F18+ CTGACAACTCTAGTGACAAAGATAAAGCGGCGGGGAAGAGGGATTCTGGTAATGAAAAAT
rJMFF034H12+ CTGACAACTCTAGTGACAAAGATAAAGCGGCGGGGAAGAGGGATTCTGGTAATGAAAAAT
                      ____________________________________________________________
consensus CTGACAACTCTAGTGACAAAGATAAAGCGGCGGGGAAGAGGGATTCTGGTAATGAAAAAT
 
. : . : . : . : . : . :
rJMFF024A10+ TCATTTTTATAGTCAAGAAGAAATCTTTGCCTTCTAGTAGCAAGGAGATTGTAGAGGAAG
rJMFF039M20+ TCATTTTTATAGTCAAGAAGAAATCTTTGCCTTCTAGTAGCAAGGAGATTGTAGAGGAAG
rJMSF035F18+ TCATTTTTATAGTCAAGAAGAAATCTTTGCCTTCTAGTAGCAAGGAGATTGTAGAGGAAG
rJMFF034H12+ TCATTTTTATAGTCAAGAAGAAATCTTTGCCTTCTAGTAGCAAGGAGATTGTAGAGGAAG
                      ____________________________________________________________
consensus TCATTTTTATAGTCAAGAAGAAATCTTTGCCTTCTAGTAGCAAGGAGATTGTAGAGGAAG
 
. : . : . : . : . : . :
rJMFF024A10+ AAAAGCCCAAGCAGGAGGAAGAGGCAAGCCTGAAAAGCAATGGATTACTATCATTATGTC
rJMFF039M20+ AAAAGCCCAAGCAGGAGGAAGAGGCAAGCCTGAAAAGCAATGGATTACTATCATTATGTC
rJMSF035F18+ AAAAGCCCAAGCAGGAGGAAGAGGCAAGCCTGAAAAGCAATGGATTACTATCATTATGTC
rJMFF034H12+ AAAAGCCCAAGCAGGAGGAAGAGGCAAGCCTGAAAAGCAATGGATTACTATCATTATGTC
                      ____________________________________________________________
consensus AAAAGCCCAAGCAGGAGGAAGAGGCAAGCCTGAAAAGCAATGGATTACTATCATTATGTC
 
. : . : . : . : . : . :
rJMFF024A10+ AACAATATGAGAGTGATGATGATGATGATGATTAGTTTGAGTATTTATGAATCTTAATTG
rJMFF039M20+ AACAATATGAGAGTGATGATGATGATGATGATTAGTTTGAGTATTTATGAATCTTAATTG
rJMSF035F18+ AACAATATGAGAGTGATGATGATGATGATGATTAGTTTGAGTATTTATGAATCTTAATTG
rJMFF034H12+ AACAATATGAGAGTGATGATGATGATGATGATTAGTTTGAGTATTTATGAATCTTAATTG
                      ____________________________________________________________
consensus AACAATATGAGAGTGATGATGATGATGATGATTAGTTTGAGTATTTATGAATCTTAATTG
 
. : . : . : . : . : . :
rJMFF024A10+ TGTAAGATATGTGTACACTGTCGATTTGAGTTCAGCTCAGGCCCAGCTCTTGGAGGATTA
rJMFF039M20+ TGTAAGATATGTGTACACTGTCGATTTGAGTTCAGCTCAGGCCCAGCTCTTGGAGGATTA
rJMSF035F18+ TGTAAGATATGTGTACACTGTCGATTTGAGTTCAGCTCAGCCCCAGCTCTTGGAGGATTA
rJMFF034H12+ TGTAAGATATGTGTACACTGTCGATTTGAGTTCAGCTCAGGCCCAGCTCTTGGAGGATTA
                      ____________________________________________________________
consensus TGTAAGATATGTGTACACTGTCGATTTGAGTTCAGCTCAGGCCCAGCTCTTGGAGGATTA
 
. : . : . : . : . : . :
rJMFF024A10+ GAAAGTGCTGCATATGGGAAAATATTTTACATTTTTTGTGTACTCAAACCAGCTCTTGGA
rJMFF039M20+ GAAAGTGCTGCATATGGGAAAATATTTTACATTTTTTGTGTACTCAAACCAGCTCTTGGA
rJMSF035F18+ GAAAGTGCTGCATATGGGAAAATATTTTACATTTTTTGTGTACTCAAACCAGCTCTTGGA
rJMFF034H12+ GAAAGTGCTGCATATGGGAAAATATTTTACATTTTTTGTGTACTCAAACCAGCTCTTGGA
                      ____________________________________________________________
consensus GAAAGTGCTGCATATGGGAAAATATTTTACATTTTTTGTGTACTCAAACCAGCTCTTGGA
 
. : . : . : . : . : . :
rJMFF024A10+ GGATTAGAAAGTGGTGCATATGGGAAAATATTT
rJMFF039M20+ GGATTAGAAAGTGGTGCATATGGGAAAATATTT
rJMSF035F18+ GGATTAGAAAGTGGTGCATATGGGAAAATATTTTACATTTTTTTTGCAAAAATTTATCGG
rJMFF034H12+ GGATTAGAAAGTGGTGCATATGGGAAAATATTTTACATTTTTTTTGCAAAAATTTATCGG
                      ____________________________________________________________
consensus GGATTAGAAAGTGGTGCATATGGGAAAATATTTTACATTTTTTTTGCAAAAATTTATCGG
 
. : . : . : . : . : . :
rJMSF035F18+ TGATAAGCATTGTTAATAGTTCCGTTTGGTAACATAGTTAGCTAACCTTGTTAAGTTGGG
rJMFF034H12+ TGATAAGCATTGTTAATAGTTCCGTTTGGTAACATAGTTAGCTAACCTTGTTAAGTTGGG
                      ____________________________________________________________
consensus TGATAAGCATTGTTAATAGTTCCGTTTGGTAACATAGTTAGCTAACCTTGTTAAGTTGGG
 
. : . : . : . : . : . :
rJMSF035F18+ GTTGGCTGATTACTTCCATTTTGTAATAGAAATAGAACAACCAAGT
rJMFF034H12+ GTTGGCTGATTACTTCCATTTTGTAATAGAAATAGAACAACCAAGTTTATCTCATTACAT
                      ____________________________________________________________
consensus GTTGGCTGATTACTTCCATTTTGTAATAGAAATAGAACAACCAAGTTTATCTCATTACAT