Previous Contig 009817:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034G02Sequence740009817 (3)gb:AF071894_17658181e-44Prunus armeniaca late embryogenesis-like protein (LEA) mRNA, partial cds.
JMFN002C07Sequence456009817 (3)gb:AY822590_16288859e-29Sesuvium portulacastrum salt tolerance protein (SRTG152) mRNA, complete cds.
JMFS082H09Sequence488009817 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS082H09+ GAAGAAAGTATTTTAAAATAAAAAATAAAAAATCAGACGGTGTTGCAAAACA
rJMFF034G02- TCAGACGGTGTTGCAAAACA
                      ____________________________________________________________
consensus GAAGAAAGTATTTTAAAATAAAAAATAAAAAATCAGACGGTGTTGCAAAACA
 
. : . : . : . : . : . :
JMFS082H09+ ATGCCGTTTTGGACCCGAGTCCATCTTGCAAGGTGGACCCATATCCACAACATAATTTGC
rJMFF034G02- ATGCCGTTTTGGACCCGAGTCCATCTTGCAAGGTGGACCCATATCCACAACATAATTTGC
                      ____________________________________________________________
consensus ATGCCGTTTTGGACCCGAGTCCATCTTGCAAGGTGGACCCATATCCACAACATAATTTGC
 
. : . : . : . : . : . :
JMFS082H09+ CATATGAACATATATCAAATGAGGCGAATATAAATTACCATATATCTATTGAACATAACC
rJMFF034G02- CATATGAACATATATCAAATGAGGCGAATATAAATTACCATATATCTATTGAACATAACC
                      ____________________________________________________________
consensus CATATGAACATATATCAAATGAGGCGAATATAAATTACCATATATCTATTGAACATAACC
 
. : . : . : . : . : . :
JMFS082H09+ ACAAACAACACGTCCGCATATCACTCTCACGGTTTAAACAACAGCCTCACTTTAAGTCTG
JMFN002C07+ TCACGGTTTAAACAACAGCCTCACTTTAAGTCTG
rJMFF034G02- ACAAACAACACGTCCGCATATCACTCTCACGGTTTAAACAACAGCCTCACTTTAAGTCTG
                      ____________________________________________________________
consensus ACAAACAACACGTCCGCATATCACTCTCACGGTTTAAACAACAGCCTCACTTTAAGTCTG
 
. : . : . : . : . : . :
JMFS082H09+ AAACACCAAAAGCACAACCAAATAACATACTTCCAAGTCTTCGTTCTAAAACACACACTC
JMFN002C07+ AAACACCAAAAGCACAACCAAATAACATACTTCCAAGTCTTCGTTCTAAAACACACACTC
rJMFF034G02- AAACACCAAAAGCACAACCAAATAACATACTTCCAAGTCTTCGTTCTAAAACACACACTC
                      ____________________________________________________________
consensus AAACACCAAAAGCACAACCAAATAACATACTTCCAAGTCTTCGTTCTAAAACACACACTC
 
. : . : . : . : . : . :
JMFS082H09+ AATTGTCTTTGAAAATCGACAACCCAGTTCAAATTCCCTGATATAAAAAATGGATTCATA
JMFN002C07+ AATTGTCTTTGAAAATCGACAACCCAGTTCAAATTCCCTGATATAAAAAATGGATTCATA
rJMFF034G02- AATTGTCTTTGAAAATCGACAACCCAGTTCAAATTCCCTGATATAAAAAATGGATTCATA
                      ____________________________________________________________
consensus AATTGTCTTTGAAAATCGACAACCCAGTTCAAATTCCCTGATATAAAAAATGGATTCATA
 
. : . : . : . : . : . :
JMFS082H09+ ATCACCATCATAACCCTGACAGTTTATTTCCCTCATCATTGTTTCACAGCTTCAATCCTC
JMFN002C07+ ATCACCATCATAACCCTGACAGTTTATTTCCCTCATCATTGTTTCACAGCTTCAATCCTC
rJMFF034G02- ATCACCATCATAACCCTGACAGTTTATTTCCCTCATCATTGTTTCACAGCTTCAATCCTC
                      ____________________________________________________________
consensus ATCACCATCATAACCCTGACAGTTTATTTCCCTCATCATTGTTTCACAGCTTCAATCCTC
 
. : . : . : . : . : . :
JMFS082H09+ CTCATCATCATCTCCCCCATCTTCCTTATTCTTCTTAAGACGGGTGGTACCACCCTCCTT
JMFN002C07+ CTCATCATCATCTCCACCATCTTCCTTATTCTTCTTAAGACGGGTGGTACCACCCTCCTT
rJMFF034G02- CTCATCATCATCTCCCCCATCTTCCTTATTCTTCTTAAGACGGGTGGTACCACCCTCCTT
                      ____________________________________________________________
consensus CTCATCATCATCTCCCCCATCTTCCTTATTCTTCTTAAGACGGGTGGTACCACCCTCCTT
 
. : . : . : . : . : . :
JMFS082H09+ GCTGATGGGTAACTTC
JMFN002C07+ GCTGATGGGTAACTTCATTGCTCCAAACGGTGTATCCACATTGATATGTCCTTTCATTGT
rJMFF034G02- GCTGATGGGTAACTTCATTGCTCCAAACGGTGTATCCACATTGATATGTCCTTTCATTGT
                      ____________________________________________________________
consensus GCTGATGGGTAACTTCATTGCTCCAAACGGTGTATCCACATTGATATGTCCTTTCATTGT
 
. : . : . : . : . : . :
JMFN002C07+ ATAGCCAGTGCCTTTACCTCTAATCATGTCCCATAGAGCAGAGCCAAAGTCCTTGGGCCT
rJMFF034G02- ATAGCCAGTGCCTTTACCTCTAATCATGTCCCATAGAGCAGAGCCAAAGTCCTTGGGCCT
                      ____________________________________________________________
consensus ATAGCCAGTGCCTTTACCTCTAATCATGTCCCATAGAGCAGAGCCAAAGTCCTTGGGCCT
 
. : . : . : . : . : . :
JMFN002C07+ GAAGGTGACGGGGAGATCAATGGAGCTAGTTCCTTTTTTCTCAATTTTGGCTGCCTTCTC
rJMFF034G02- GAAGGTGACGGGGAGATCAATGGAGCTAGTTCCTTTTTTCTCAATTTTGGCTGCCTTCTC
                      ____________________________________________________________
consensus GAAGGTGACGGGGAGATCAATGGAGCTAGTTCCTTTTTTCTCAATTTTGGCTGCCTTCTC
 
. : . : . : . : . : . :
JMFN002C07+ AA
rJMFF034G02- AAGTTCTGCACTCCCAATGCTCACATCAGAGAGCCAAAGCTCATAGTCAAGTGAATTGAG
                      ____________________________________________________________
consensus AAGTTCTGCACTCCCAATGCTCACATCAGAGAGCCAAAGCTCATAGTCAAGTGAATTGAG
 
. : . : . : . : . : . :
rJMFF034G02- CCCCAGATCAAAGTCATTCATGTTTTCCAATTTCAAGTGAAGAATAGCAACAGTTTCTTC
                      ____________________________________________________________
consensus CCCCAGATCAAAGTCATTCATGTTTTCCAATTTCAAGTGAAGAATAGCAACAGTTTCTTC