Previous Contig 009815:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034F10Sequence456001528 (9)gb:OSJN00157_16958584e-07Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0013K16, complete seque747009815 (6)gb:AP003106_18247644e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P066
JMFF035L04Sequence594001528 (9)gb:AB016892_15132313e-19Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXF12.719009815 (6)gb:ATAC011437_15432812e-40Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence, complete sequenc
JMFS071H02Sequence625009815 (6)gb:AP003106_18247644e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P066
JMFS131C11Sequence467009815 (6)gb:AY035053_15598306e-13Arabidopsis thaliana putative receptor-protein kinase (At3g51550) mRNA, complete
JMSF022E18Sequence689001528 (9)gb:AB016892_15132314e-29Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXF12.711009815 (6)gb:AP003106_18247644e-42Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P066
JMSF023N16Sequence689001528 (9)gb:AB016892_15132314e-29Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXF12.618009815 (6)gb:ATAC011437_15432814e-25Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022E18+ GTCAGCACCGCCGTC
JMFS071H02+ GTCAGCACCGCCGTC
rJMFF034F10+ AGCCGTAAGCCACGTCAGCACCGCCGTC
                      ____________________________________________________________
consensus AGCCGTAAGCCACGTCAGCACCGCCGTC
 
. : . : . : . : . : . :
rJMFF035L04+ AAGGGCAGCTTCGGGTACGTTGACCCGGAGTACTACAGACGGCGTCAGGTAACGGAAAAG
rJMSF022E18+ AAGGGCAGCTTCGGGTACGTTGACCCGGAGTACTACAGACGGCGTCAGGTAACGGAAAAG
JMFS071H02+ AAGGGCAGCTTCGGGTACGTTGACCCGGAGTACTACAGACGGCGTCAGGTAACGGAAAAG
rJMFF034F10+ AAGGGCAGCTTCGGGTACGTTGACCCGGAGTACTACAGACGGCGTCAGGTAACGGAAAAG
                      ____________________________________________________________
consensus AAGGGCAGCTTCGGGTACGTTGACCCGGAGTACTACAGACGGCGTCAGGTAACGGAAAAG
 
. : . : . : . : . : . :
rJMFF035L04+ TCCGATGTTTACTCCTTCGGAGTTGTCTTGTTCGAAGTGTTGTGCGCTAGGGCCGCCGTG
rJMSF022E18+ TCCGATGTTTACTCCTTCGGAGTTGTCTTGTTCGAAGTGTTGTGCGCTAGGGCCGCCGTG
JMFS071H02+ TCCGATGTTTACTCCTTCGGAGTTGTCTTGTTCGAAGTGTTGTGCGCTAGGGCCGCCGTG
rJMSF023N16+ CGGAGTTGTCTTGTTCGAAGTGTTNTGCGCTAGGGCCGCCGTG
rJMFF034F10+ TCCGATGTTTACTCCTTCGGAGTTGTCTTGTTCGAAGTGTTGTGCGCTAGGGCCGCCGTG
                      ____________________________________________________________
consensus TCCGATGTTTACTCCTTCGGAGTTGTCTTGTTCGAAGTGTTGTGCGCTAGGGCCGCCGTG
 
. : . : . : . : . : . :
rJMFF035L04+ ATTCCAAATCTGCCGAGAAATAAAGTCAGTCTGGCGGAGTGGGGCCGCCGGAGTTATGAA
rJMSF022E18+ ATTCCAAATCTGCCGAGAAATAAAGTCAGTCTGGCGGAGTGGGGCCGCCGGAGTTATGAA
JMFS131C11+ ATAAAGTCAGTCTGGCGGAGTGGGGCCGCCGGAGTTATGAA
JMFS071H02+ ATTCCAAATCTGCCGAGAAATAAAGTCAGTCTGGCGGAGTGGGGCCGCCGGAGTTATGAA
rJMSF023N16+ ATTCCAAATCTGCCGAGAAATAAAGTCAGTCTGNCGGAGTGGGGCCGCCGGAGTTATGAA
rJMFF034F10+ ATTCCAAATCTGCCGAGAAATAAAGTCAGTCTGGCGGAGTGGGGCCGCCGGAGTTATGAA
                      ____________________________________________________________
consensus ATTCCAAATCTGCCGAGAAATAAAGTCAGTCTGGCGGAGTGGGGCCGCCGGAGTTATGAA
 
. : . : . : . : . : . :
rJMFF035L04+ ACGGGGGACGTCAGCGAGATTGTGGACCCGAATTTGAAGGGCCAGATCGCGTCGGAGTGT
rJMSF022E18+ ACGGGGGACGTCAGCGAGATTGTGGACCCGAATTTGAAGGGCCAGATCGCGTCGGAGTGT
JMFS131C11+ ACGGGGGACGTCAGCAAGATTGTGGACCCGGATTTAGAGGGCCAGATCGCGTCGGAGTGT
JMFS071H02+ ACGGGGGACGTCAGCGAGATTGTGGACCCGAATTTGAAGGGCCAGATCGCGTCGGAGTGT
rJMSF023N16+ ACGGGGGACGTCAGCGAGATTGTGGACCCGAATTTGAAGGGNCAGATCGCGTCGGAGTGT
rJMFF034F10+ ACGGGGGACGTCAGCGAGATTGTGGACCCGAATTTGAAGGGCCAGATCGCGTCGGAGTGT
                      ____________________________________________________________
consensus ACGGGGGACGTCAGCGAGATTGTGGACCCGAATTTGAAGGGCCAGATCGCGTCGGAGTGT
 
. : . : . : . : . : . :
rJMFF035L04+ CTGATCCAGTACGTGGAGATCGCCTGCAATTGCCTGAAGGATCAAGGGATCGATCGGCCG
rJMSF022E18+ CTGATCCAGTACGTGGAGATCGCCTGCAATTGCCTGAAGGATCAAGGGATCGATCGGCCG
JMFS131C11+ CTGATCCAGTACGTGGAGATCGCCTGCAATTGCCTGAAGGATCAAGGGGTCGGTCGGCCG
JMFS071H02+ CTGATCCAGTACGTGGAGATCGCCTGCAATTGCCTGAAGGATCAAGGGATCGATCGGCCG
rJMSF023N16+ CTGATCCAGTACGTGGAGATCGCCTGCAATTGCCTGAAGGATCAAGGGATCGATCGGCCG
rJMFF034F10+ CTGATCCAGTACGTGGAGATCGCCTGCAATTGCCTGAAGGATCAAGGGATCGATCGGCCG
                      ____________________________________________________________
consensus CTGATCCAGTACGTGGAGATCGCCTGCAATTGCCTGAAGGATCAAGGGATCGATCGGCCG
 
. : . : . : . : . : . :
rJMFF035L04+ GCGATGAACGATGTGGTGTGGGGCCTTGAGTTTGCGTTGCAGCTCCAAGATGCGGCCGAT
rJMSF022E18+ GCGATGAACGATGTGGTGTGGGGCCTTGAGTTTGCGTTGCAGCTCCAAGATGCGGCCGAT
JMFS131C11+ GCGATGCTCGATGTGGTGTGGGGCCTTGAGTTCGCGCGCGCGCTCC-AGATGCGGCCGAT
JMFS071H02+ GCGATGAACGATGTGGTGTGGGGCCTTGAGTTTGCGTTGCAGCTCCAAGATGCGGCCGAT
rJMSF023N16+ GCGATGAACGATGTGGTGTGGGGCCTTGAGTTTGCGTTGCAGCTCCAAGATGCGGCCGAT
rJMFF034F10+ GCGATGAACGATGTGGTGTGGGGCCTTGAGTTTGCGTTGCAGCTCCAAGATGCGGCCGAT
                      ____________________________________________________________
consensus GCGATGAACGATGTGGTGTGGGGCCTTGAGTTTGCGTTGCAGCTCCAAGATGCGGCCGAT
 
. : . : . : . : . : . :
rJMFF035L04+ AAGAGAGGCGGCCTCTCTCCGCCGCGCACGCCGGAGAGGCCGGGCTTTCCTTTGCTTGCA
rJMSF022E18+ AAGAGAGGCGGCCTCTCTCCGCCGCGCACGCCGGAGAGGCCGGGCTTTCCTTTGCTTGCA
JMFS131C11+ AAGAGAGGCGGCCTCTCTCCTCCGCGCGCGCCGGAGAGGCCGGGCTTTCCTTTGCTCGCA
JMFS071H02+ AAGAGAGGCGGCCTCTCTCCGCCGCGCACGCCGGAGAGGCCGGGCTTTCCTTTGCTTGCA
rJMSF023N16+ AAGAGAGGCGGCCTCTCTCCGCCGCGCACGCCGGAGAGGCCGGGCTTTCCTTTGCTTGCA
rJMFF034F10+ AAGAGAGGCGGCCTCTCTCCGCCGCGCACGCCGGAGAGGCCGGGCTTTCCTTTGCTTGCA
                      ____________________________________________________________
consensus AAGAGAGGCGGCCTCTCTCCGCCGCGCACGCCGGAGAGGCCGGGCTTTCCTTTGCTTGCA
 
. : . : . : . : . : . :
rJMFF035L04+ AAGGGCGGCGACGGCGAGGCGGCAAATAAGTCAGACGAGGATTATGGTGGCGCGTTTACT
rJMSF022E18+ AAGGGCGGCGACGGCGAGGCGGCAAATAAGTCAGACGAGGATTATGGTGGCGCGTTTACT
JMFS131C11+ CAGGCCCGCGCCCGCGAGCCGGCGAGTGAGTCCGCGCGGGATTGTGGTGGCGCGTTTGCT
JMFS071H02+ AAGGGCGGCGACGGCGAGGCGGCAAATAAGTCAGACGAGGATTATGGTGGCGCGTTTACT
rJMSF023N16+ AAGGGCGGNGACGGCGAGGCGGCAAATAAGTCAGACGAGGATTATGGTGGCGCGTTTANT
rJMFF034F10+ AAGGGCGGCGACGGCGAGGCGGCAAATAAGTCAGACGAGGATTATGGTGGCGCGTTTACT
                      ____________________________________________________________
consensus AAGGGCGGCGACGGCGAGGCGGCAAATAAGTCAGACGAGGATTATGGTGGCGCGTTTACT
 
. : . : . : . : . : . :
rJMFF035L04+ ACATCCGAAAACGCTGAAAAATTGTTCAGGACTAAAAGCAGTGCCACTGCTACTTCTACA
rJMSF022E18+ ACATCCGAAAACGCTGAAAAATTGTTCAGGACTAAAAGCAGTGCCACTGCTACTTCTACA
JMFS131C11+ ACATCGGGAAACGCTGAAAAATTGTTCGGGAGTGAAAGCAGTGCCCCTGCTACTTCTACA
JMFS071H02+ ACATCCGAAAACGCTGAAAAATTGTTCAGGACTAAAAGCAGTGCCACTGCTACTTCTACA
rJMSF023N16+ ACATCCGAAAACGCTGAAAAATTNTTCAGGACTAAAAGCAGTGCCACTGCTACTTCTACA
rJMFF034F10+ ACATCCGAAAACGCTGAAAAATTGTTCAGGACTAAAAGCAGTGCCACTGCTACTTCTACA
                      ____________________________________________________________
consensus ACATCCGAAAACGCTGAAAAATTGTTCAGGACTAAAAGCAGTGCCACTGCTACTTCTACA
 
. : . : . : . : . : . :
rJMFF035L04+ AGTGATGATAGTTTGAGGGGACAATCTCACACTATTTTTTCAGAGCTCAGTAATCAATTG
rJMSF022E18+ AGTGATGATAGTTTGAGGGGACAATCTCACACTATTTTTTCAGAGCTCAGTAATCAATTG
JMFS131C11+ AGTGATGATAGTTTGAGGGGACAATCTCACACTATTTTTTCAGAGCTCAGTAATCAATTG
JMFS071H02+ AGTGATGATAGTTTGAGGGGACAATCTCACACTATTTTTTCAGAGCTCAGTAATCAATTG
rJMSF023N16+ AGTGATGATAGTTTGAGGGGNCAATCTCACACTATTTTTTCAGAGCTCAGTAATCAATTG
rJMFF034F10+ AGTGATGATAGTTTGAGGGGACAATCTCACACTATTTTTTCAGAGCTCAGTAATCAATTG
                      ____________________________________________________________
consensus AGTGATGATAGTTTGAGGGGACAATCTCACACTATTTTTTCAGAGCTCAGTAATCAATTG
 
. : . : . : . : . : . :
rJMFF035L04+ GGTCGTTAATACATACAGAATACATTGTTCTACTATACTTGGAACAACATTTAGCAGCTA
rJMSF022E18+ GGTCGTTAATACATACAGAATACATTGTTCTACTATACTTGGAACAACATTTAGCAGCTA
JMFS131C11+ GGTCGTT
JMFS071H02+ GGTCGTT
rJMSF023N16+ GGTCGTTAATACATACAGAATACNTTGTTCTACTATACTTGGAACAACATTTAGCAGCNA
rJMFF034F10+ GGTCGTTAATACATACAGAATACATTGTTCTACTATACTTGGAACAACATTTAGCAGCTA
                      ____________________________________________________________
consensus GGTCGTTAATACATACAGAATACATTGTTCTACTATACTTGGAACAACATTTAGCAGCTA
 
. : . : . : . : . : . :
rJMFF035L04+ TATGTATCAAC-TAATTTTGATAAACTACATATGTGTGTTATTTTGTATTTTCAGCTTAA
rJMSF022E18+ TATGTATCAAC-TAATTTTGATAAACTACATATGT
rJMSF023N16+ TATGTATCAACATAATTTTGATAAACTACATATGT
rJMFF034F10+ TATGTATCAAC-TAATTTTGATAAACTACATATGTGTGTTATTTTGTATTTTCAGCTTAA
                      ____________________________________________________________
consensus TATGTATCAAC-TAATTTTGATAAACTACATATGTGTGTTATTTTGTATTTTCAGCTTAA