Previous Contig 009811:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010M18Sequence526000564 (6)686009811 (2)sp|Q9SA65|CAP4_ARATH1e-17Putative clathrin assembly protein At1g03050.>pir|C86161|C86161 hypothetical pro
JMFF034E17Sequence533000564 (6)598009811 (2)sp|Q9SA65|CAP4_ARATH1e-10Putative clathrin assembly protein At1g03050.>pir|C86161|C86161 hypothetical pro

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF010M18+ GGCAGCGCTAGCAGCGTGGCNTTCGGTTCGGCCGGGCGCCCCGCAATGCTGGCTCTGCC
                      ____________________________________________________________
consensus GGCAGCGCTAGCAGCGTGGCNTTCGGTTCGGCCGGGCGCCCCGCAATGCTGGCTCTGCC
 
. : . : . : . : . : . :
rJMFF010M18+ GGCACCGACCTCCGGCGCAGCCTACACAGCTCAGGGAATGGACCCTTTCGCCGCCTCGCT
                      ____________________________________________________________
consensus GGCACCGACCTCCGGCGCAGCCTACACAGCTCAGGGAATGGACCCTTTCGCCGCCTCGCT
 
. : . : . : . : . : . :
rJMFF010M18+ CTCCATTCCGCCGCCGGCGTACGTGCAGATGTCGGAGATAGAGAGGAAACAGAGACTGTT
rJMFF034E17+ TCCATTCCGCCGCCGGCGTACGTGCAGATGTCGGAGATAGAGAGGAAACAGAGACTGTT
                      ____________________________________________________________
consensus CTCCATTCCGCCGCCGGCGTACGTGCAGATGTCGGAGATAGAGAGGAAACAGAGACTGTT
 
. : . : . : . : . : . :
rJMFF010M18+ AATGGAAGAACAGCTGATGTGGCATCAATTTTCCAGAGATGGAATGCAAGGGCAGGCAGG
rJMFF034E17+ AATGGAAGAACAGCTGATGTGGCATCAATTTTCCAGAGATGGAATGCAAGGGCAGGCAGG
                      ____________________________________________________________
consensus AATGGAAGAACAGCTGATGTGGCATCAATTTTCCAGAGATGGAATGCAAGGGCAGGCAGG
 
. : . : . : . : . : . :
rJMFF010M18+ TTTTGCTAATGTTCATCAACCAAATCCCTACACAAGAACCTACTCAAACAAGTATTGATT
rJMFF034E17+ TTTTGCTAATGTTCATCAACCAAATCCCTACACAAGAACCTACTCAAACAAGTATTGATT
                      ____________________________________________________________
consensus TTTTGCTAATGTTCATCAACCAAATCCCTACACAAGAACCTACTCAAACAAGTATTGATT
 
. : . : . : . : . : . :
rJMFF010M18+ GCAAGTTTTCCCCGACACCCAAAAAAACATGAAACAATAAACACTTTGATAGTGGTTGCG
rJMFF034E17+ GCAAGTTTTCCCCGACACCCAAAAAAACATGAAACAATAAACACTTTGATAGTGGTTGCG
                      ____________________________________________________________
consensus GCAAGTTTTCCCCGACACCCAAAAAAACATGAAACAATAAACACTTTGATAGTGGTTGCG
 
. : . : . : . : . : . :
rJMFF010M18+ AGTTTTTCTCGTCACCCTAAAAAACATATATACATATATATACTTTGGTAGTGGACAGTG
rJMFF034E17+ AGTTTTTCTCGTCACCCT-AGAAACATATATACATATATATACTTTGGTAGTGGACAGTG
                      ____________________________________________________________
consensus AGTTTTTCTCGTCACCCTAAGAAACATATATACATATATATACTTTGGTAGTGGACAGTG
 
. : . : . : . : . : . :
rJMFF010M18+ GCTGCGAGTTTCTTCTGTCACCAAAAAAAGGGTTAATACATCCAATGGTCTTTCGATCCT
rJMFF034E17+ GCTGCGAGTTTCTTCTGTCACCAAAAAAAGGGTTAATACATCCAATGGTCTTTCGATCCT
                      ____________________________________________________________
consensus GCTGCGAGTTTCTTCTGTCACCAAAAAAAGGGTTAATACATCCAATGGTCTTTCGATCCT
 
. : . : . : . : . : . :
rJMFF010M18+ AATTTTTTTTAAAAACCCAAGTTTAAAATGACCACGAGACGTCCTAAAAGGACCATGGGT
rJMFF034E17+ AATTTTTTTTAAAAACCCAAGTTTAAAATGACCACGAGACGTCCTAAAAGGACCATGGGT
                      ____________________________________________________________
consensus AATTTTTTTTAAAAACCCAAGTTTAAAATGACCACGAGACGTCCTAAAAGGACCATGGGT
 
. : . : . : . : . : . :
rJMFF010M18+ GGTTATTTTTTAAAACATGGAGGATCATTGGAGATCATTTAAAACTCAAATGATCACAGT
rJMFF034E17+ GGTTATTTTTTAAAACATGGAGGATCATTGGAGATCATTTAAAACTCAAATGATCACAGT
                      ____________________________________________________________
consensus GGTTATTTTTTAAAACATGGAGGATCATTGGAGATCATTTAAAACTCAAATGATCACAGT
 
. : . : . : . : . : . :
rJMFF010M18+ TGGTAAATCGCTAATACTCGGAAGACCATTGGAGGTATTAACTCCAAAAAAAACATATAT
rJMFF034E17+ TGGTAAATCGCTAATACTCGGAAGACCATTGGAGGTATTAACTCCAAAAAAAACATATAT
                      ____________________________________________________________
consensus TGGTAAATCGCTAATACTCGGAAGACCATTGGAGGTATTAACTCCAAAAAAAACATATAT
 
. : . : . : . : . : . :
rJMFF010M18+ ATGTATGTATATCATGATGAGCTCTCA
rJMFF034E17+ ATGTATGTATATCATGATGAGCTCTCAGCTGTAACTCGTTCTTTTTTGTACAGTTATGGT
                      ____________________________________________________________
consensus ATGTATGTATATCATGATGAGCTCTCAGCTGTAACTCGTTCTTTTTTGTACAGTTATGGT