Previous Contig 009810:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034D24Sequence509009810 (6)gb:AB023032_15153362e-35Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5J14.>gb:AY072534_156576009810 (6)gb:AB023032_15153362e-35Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5J14.>gb:AY072534_156
JMFN017H17Sequence450009810 (6)gb:AB023032_15153362e-26Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5J14.>gb:AY072534_156
JMFN018F03Sequence482009810 (6)gb:AB023032_15153362e-35Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5J14.>gb:AY072534_156
JMFN034M24Sequence498009810 (6)gb:AB023032_15153362e-35Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5J14.>gb:AY072534_156
JMFS065B05Sequence459009810 (6)gb:AB023032_15153361e-35Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5J14.>gb:AY072534_156

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN034M24+ CACCAAAGACCTTTAAAAATTTACAATTCTACGAATCCAGAACTGT
rJMFF034D24- CCTTTAAAAATTTACAATTCTACGAATCCAGAACTGT
                      ____________________________________________________________
consensus CACCAAAGACCTTTAAAAATTTACAATTCTACGAATCCAGAACTGT
 
. : . : . : . : . : . :
JMFN034M24+ CAAAATTCCAAACAACCAACATTAGAGATCACCAAACAACAGAATTCCACATTATTTCAT
JMFN018F03+ GATCACCAAACAACAGAATTCCACATTATTTCAT
JMFS065B05+ GATCACCAAACAACAGAATTCCACATTATTTCAT
JMFF034D24+ ATTAGAGATCACCAAACAACAGAATTCCACATTATTTCAT
JMFN017H17+ GATCACCAAACAACAGAATTCCACATTATTTCAT
rJMFF034D24- CAAAATTCCAAACAACCAACATTAGAGATCACCAAACAACAGAATTCCACATTATTTCAT
                      ____________________________________________________________
consensus CAAAATTCCAAACAACCAACATTAGAGATCACCAAACAACAGAATTCCACATTATTTCAT
 
. : . : . : . : . : . :
JMFN034M24+ GAAATTCAACGAGTAGGAAATATAACTAGAGATCCGAGGGATCAAACCAACCGCAAACAT
JMFN018F03+ GAAATTCAACGAGTAGGAAATATAACTAGAGATCCGAGGGATCAAACCAACCGCAAACAT
JMFS065B05+ GAAATTCAACGAGTAGGAAATATAACTAGAGATCCGAGGGATCAAACCAACCGCAAACAT
JMFF034D24+ GAAATTCAACGAGTAGGAAATATAACTAGAGATCCGAGGGATCAAACCAACCGCAAACAT
JMFN017H17+ GAAATTCAACGAGTAGGAAATATAACTAGAGATCCGAGGGATCAAACCAACCGCAAACAT
rJMFF034D24- GAAATTCAACGAGTAGGAAATATAACTAGAGATCCGAGGGATCAAACCAACCGCAAACAT
                      ____________________________________________________________
consensus GAAATTCAACGAGTAGGAAATATAACTAGAGATCCGAGGGATCAAACCAACCGCAAACAT
 
. : . : . : . : . : . :
JMFN034M24+ TAAAGACATCGTCTTCATCATAAACTACGATAGACAAGGGTTCAATTACACGGTAACAGA
JMFN018F03+ TAAAGACATCGTCTTCATCATAAACTACGATAGACAAGGGTTCAATTACACGGTAACAGA
JMFS065B05+ TAAAGACATCGTCTTCATCATAAACTACGATAGACAAGGGTTCAATTACACGGTAACAGA
JMFF034D24+ TAAAGACATCGTCTTCATCATAAACTACGATAGACAAGGGTTCAATTACACGGTAACAGA
JMFN017H17+ TAAAGACATCGTCTTCATCATAAACTACGATAGACAAGGGTTCAATTACACGGTAACAGA
rJMFF034D24- TAAAGACATCGTCTTCATCATAAACTACGATAGACAAGGGTTCAATTACACGGTAACAGA
                      ____________________________________________________________
consensus TAAAGACATCGTCTTCATCATAAACTACGATAGACAAGGGTTCAATTACACGGTAACAGA
 
. : . : . : . : . : . :
JMFN034M24+ CGATAGTAAAGAGACTTAATTGTAGTAGAGCTCAAGGCCCATGCCGTCATGGATTTCGTA
JMFN018F03+ CGATAGTAAAGAGACTTAATTGTAGTAGAGCTCAAGGCCCATGCCGTCATGGATTTCGTA
JMFS065B05+ CGATAGTAAAGAGACTTAATTGTAGTAGAGCTCAAGGCCCATGCCGTCATGGATTTCGTA
JMFF034D24+ CGATAGTAAAGAGACTTAATTGTAGTAGAGCTCAAGGCCCATGCCGTCATGGATTTCGTA
JMFN017H17+ CGATAGTAAAGAGACTTAATTGTAGTAGAGCTCAAGGCCCATGCCGTCATGGATTTCGTA
rJMFF034D24- CGATAGTAAAGAGACTTAATTGTAGTAGAGCTCAAGGCCCATGCCGTCATGGATTTCGTA
                      ____________________________________________________________
consensus CGATAGTAAAGAGACTTAATTGTAGTAGAGCTCAAGGCCCATGCCGTCATGGATTTCGTA
 
. : . : . : . : . : . :
JMFN034M24+ GTCCTTGAGGGTGATATGGTCCTTGTAGATGGTGTACCACTTCTGAATTCGGATCTTATC
JMFN018F03+ GTCCTTGAGGGTGATATGGTCCTTGTAGATGGTGTACCACTTCTGAATTCGGATCTTATC
JMFS065B05+ GTCCTTGAGGGTGATATGGTCCTTGTAGATGGTGTACCACTTCTGAATTCGGATCTTATC
JMFF034D24+ GTCCTTGAGGGTGATATGGTCCTTGTAGATGGTGTACCACTTCTGAATTCGGATCTTATC
JMFN017H17+ GTCCTTGAGGGTGATATGGTCCTTGTAGATGGTGTACCACTTCTGAATTCGGATCTTATC
rJMFF034D24- GTCCTTGAGGGTGATATGGTCCTTGTAGATGGTGTACCACTTCTGAATTCGGATCTTATC
                      ____________________________________________________________
consensus GTCCTTGAGGGTGATATGGTCCTTGTAGATGGTGTACCACTTCTGAATTCGGATCTTATC
 
. : . : . : . : . : . :
JMFN034M24+ GGCCCGGGTTCCGGTCTGCGCCGCCACCAGCTTCTTCAGGTCTCCGATGGTGTCGTCATC
JMFN018F03+ GGCCCGGGTTCCGGTCTGCGCCGCCACCAGCTTCTTCAGGTCTCCGATGGTGTCGTCATC
JMFS065B05+ GGCCCGGGTTCCGGTCTGCGCCGCCACCAGCTTCTTCAGGTCTCCGATGGTGTCGTCATC
JMFF034D24+ GGCCCGGGTTCCGGTCTGCGCCGCCACCAGCTTCTTCAGGTCTCCGATGGTGTCGTCATC
JMFN017H17+ GGCCCGGGTTCCGGTCTGCGCCGCCACCAGCTTCTTCAGGTCTCCGATGGTGTCGTCATC
rJMFF034D24- GGCCCGGGTTCCGGTCTGCGCCGCCACCAGCTTCTTCAGGTCTCCGATGGTGTCGTCATC
                      ____________________________________________________________
consensus GGCCCGGGTTCCGGTCTGCGCCGCCACCAGCTTCTTCAGGTCTCCGATGGTGTCGTCATC
 
. : . : . : . : . : . :
JMFN034M24+ GTTGC-ACTTCACCCTCACCTTCTTCCCTAGACGGTCGTTCAGCACCACCTCGATCATCT
JMFN018F03+ GTTGC-ACTTCACCCTCACCTTCTTCCCTAGACGGTCGTTCAGCACCACCTCGATCATCT
JMFS065B05+ GTTGC-ACTTCACCCTCACCTTCTTCCCTAGACGGTCGTTCAGCACCACCTCGATCATCT
JMFF034D24+ GTTGC-ACTTCACCCTCACCTTCTTCCCTAGACGGTCGTTCAGCACCACCTCGATCATCT
JMFN017H17+ GTTGCTACTTCACCCTCACCTTCTTCCCTAGACGGTCGTTCAGCACCACCTCGATCATCT
rJMFF034D24- GTTGC-ACTTCACCCTCACCTTCTTCCCTAGACGGTCGTTCAGCACCACCTCGATCATCT
                      ____________________________________________________________
consensus GTTGC-ACTTCACCCTCACCTTCTTCCCTAGACGGTCGTTCAGCACCACCTCGATCATCT
 
. : . : . : . : . : . :
JMFN034M24+ TCGCACTTCGCGTGTTCCCTCCCCTCGAAATCG
JMFN018F03+ TCGCACTTCGCGTGTTCCCTCCCCTCGAAATCGTAGCTCCGGCGTCGTCTCCGAATTGAT
JMFS065B05+ TCGCACTTCGCGTGTTCCCTCCCCTCGAAATCGTAGCTCCGG
JMFF034D24+ TCGCACTTCGCGTGTTCCCTCCCCTCGAAATCGTAGCTCCGGCGTCGTCTCCGAATTGAT
JMFN017H17+ TCGCACTTCGCGTGTTCCCTCCCCTCGAAATCGTA
rJMFF034D24- TCGCACTTCGCGTGTTCCCTCCCCTCGAAATCGTAGCTCCGGCGTCGTCTCCGAATTGAT
                      ____________________________________________________________
consensus TCGCACTTCGCGTGTTCCCTCCCCTCGAAATCGTAGCTCCGGCGTCGTCTCCGAATTGAT
 
. : . : . : . : . : . :
JMFN018F03+ TGGAACGGGGCAAAGACACGGTATATATA
JMFF034D24+ TGGAACGGGGCAAAGACACGGTATATATAGAGATAACCAATACTCCAATC
rJMFF034D24- TGGAACGGGGCAAAGACACGGTATATATAGAGATAACCAATACTCCAATCACAGCGATGA
                      ____________________________________________________________
consensus TGGAACGGGGCAAAGACACGGTATATATAGAGATAACCAATACTCCAATCACAGCGATGA