Previous Contig 009801:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034B21Sequence437007342 (3)gb:AY484589_16083322e-17Musa acuminata clone MuH9, genomic sequence.713009801 (2)gb:ATH510211_15528354e-36Arabidopsis thaliana ari8 gene for ARIADNE-like protein ARI8, exons 1-15.>gb:AY0
JMSF040D07Sequence664007342 (3)gb:AY484589_16083323e-43Musa acuminata clone MuH9, genomic sequence.853009801 (2)gb:OSJN00138_16955186e-63Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040D07+ CACAGTTGAAGTT
                      ____________________________________________________________
consensus CACAGTTGAAGTT
 
. : . : . : . : . : . :
rJMSF040D07+ CATAATAGATGCTTGGCTGCAGATAGTTGAATGTAGACGGGTGCTAAAATGGACTTATGC
                      ____________________________________________________________
consensus CATAATAGATGCTTGGCTGCAGATAGTTGAATGTAGACGGGTGCTAAAATGGACTTATGC
 
. : . : . : . : . : . :
rJMSF040D07+ ATATGGATATTACTTACCTGAGCATGACCGTGCTAAGAGGCAATTCTTCGAGTATCTACA
                      ____________________________________________________________
consensus ATATGGATATTACTTACCTGAGCATGACCGTGCTAAGAGGCAATTCTTCGAGTATCTACA
 
. : . : . : . : . : . :
rJMSF040D07+ AGGTGAAGCTGAATCTGGGTTAGAGCGGCTTCATCAATGTGCCGAGAAGGAACTCCAAAG
rJMFF034B21+ GCTGAATCTGGGTTAGAGCGGCTTCATCAATGTGCCGAGAAGGAACTCCAAAG
                      ____________________________________________________________
consensus AGGTGAAGCTGAATCTGGGTTAGAGCGGCTTCATCAATGTGCCGAGAAGGAACTCCAAAG
 
. : . : . : . : . : . :
rJMSF040D07+ ATACCTTAATGCAGATGGTCCATCAAAAGACTTCAATGAGTTCCGCACAAAGCTAGCAGG
rJMFF034B21+ ATACNTTAATGCAGATGGTCCATCAAAAGACTTCAATGAGTTCCGCACAAAGCTAGCAGG
                      ____________________________________________________________
consensus ATACCTTAATGCAGATGGTCCATCAAAAGACTTCAATGAGTTCCGCACAAAGCTAGCAGG
 
. : . : . : . : . : . :
rJMSF040D07+ GCTAACAAGTGTCACTCGAAATTACTTTGAAAACCTGGTCCGAGCTTTAGAGAACGGTCT
rJMFF034B21+ GCTAACAAGTGTCACTCGAAATTACTTTGAAAACCTGGTCCGAGCTTTAGAGAACGGTCT
                      ____________________________________________________________
consensus GCTAACAAGTGTCACTCGAAATTACTTTGAAAACCTGGTCCGAGCTTTAGAGAACGGTCT
 
. : . : . : . : . : . :
rJMSF040D07+ GTCAGACGTGGACCCTCGAGGTGCTTGCAGCAGGGCAACGAGTTCAAAAAACCTGGGATG
rJMFF034B21+ GTCAGACGTGGACCCTCGAGGTGCTTGCAGCAGGGCAACGAGTTCAAAAAACCTGGGATG
                      ____________________________________________________________
consensus GTCAGACGTGGACCCTCGAGGTGCTTGCAGCAGGGCAACGAGTTCAAAAAACCTGGGATG
 
. : . : . : . : . : . :
rJMSF040D07+ CTTAAGCAGCAAAGGGAGCAGAAGCAGAAGCAGGGGAACCACATCCAGATCATCAAGCAG
rJMFF034B21+ CTTAAGCAGCAAAGGGAGCAGAAGCAGAAGCAGGGGAACCACATCCAGATCATCAAGCAG
                      ____________________________________________________________
consensus CTTAAGCAGCAAAGGGAGCAGAAGCAGAAGCAGGGGAACCACATCCAGATCATCAAGCAG
 
. : . : . : . : . : . :
rJMSF040D07+ TTCCAAAAACATAGACGATTCTGGACACTGGTCTTGTCAATACTGCACATTTGCCAACGT
rJMFF034B21+ TTCCAAAAACATAGACGATTCTGGACACTGGTCTTGTCAATACTGCACATTTGCCAACGT
                      ____________________________________________________________
consensus TTCCAAAAACATAGACGATTCTGGACACTGGTCTTGTCAATACTGCACATTTGCCAACGT
 
. : . : . : . : . : . :
rJMSF040D07+ TAGATCTGCTAATATTTGTCAGATGTGTCAGCAACGCCCTTGAAGCGAATTCAACTTGCA
rJMFF034B21+ TAGATCTGCTAATATTTGTCAGATGTGTCAGCAACGCCCTTGAAGCGAATTCAACTTGCA
                      ____________________________________________________________
consensus TAGATCTGCTAATATTTGTCAGATGTGTCAGCAACGCCCTTGAAGCGAATTCAACTTGCA
 
. : . : . : . : . : . :
rJMSF040D07+ GTGAATTCTGATACCGCATCTACTGAAGACTGGGTCATCGGGGAAATGAGGTAAAAGGAG
rJMFF034B21+ GTGAATTCTGATACCGCATCTACTGAAGACTGGGTCATCGGGGAAATGAGGTAAAAGGAG
                      ____________________________________________________________
consensus GTGAATTCTGATACCGCATCTACTGAAGACTGGGTCATCGGGGAAATGAGGTAAAAGGAG
 
. : . : . : . : . : . :
rJMSF040D07+ GATATCGGATTACCACGTTCCCTTCAAAACCCTTTCCCATCCCAGCAGAGATGCTGTACA
rJMFF034B21+ GATATCGGATTACCACGTTCCCTTCAAAACCCTTTCCCATCCCAGCAGAGATGCTGTACA
                      ____________________________________________________________
consensus GATATCGGATTACCACGTTCCCTTCAAAACCCTTTCCCATCCCAGCAGAGATGCTGTACA
 
. : . : . : . : . : . :
rJMSF040D07+ TAGTTCAGGTTGTGTCTTGTGTGTGTTTCCTATATATAATATCCTGTAACAACATCCTTT
rJMFF034B21+ TAGTTCAGGTTGTGTCTTGTGTGTGTTTCCTATATATAATATCCTGTAACAACATCCTTT
                      ____________________________________________________________
consensus TAGTTCAGGTTGTGTCTTGTGTGTGTTTCCTATATATAATATCCTGTAACAACATCCTTT
 
. : . : . : . : . : . :
rJMSF040D07+ CATAGAACCTCATTTTCATGTTTTATTTTATTTATATTGCTATTTAGGACGCAGGAAAAA
rJMFF034B21+ CATAGAACCTCATTTTCATGTTTTATTTTATTTATATTGCTATTTAGGACGCAGGAAAAA
                      ____________________________________________________________
consensus CATAGAACCTCATTTTCATGTTTTATTTTATTTATATTGCTATTTAGGACGCAGGAAAAA
 
. : . : . : . : . : . :
rJMSF040D07+ TCTGCTGGCTTAAAGCTGTTGTATTGTACACTACTTCTATAGGGAGTCATAATATAACTA
rJMFF034B21+ TCTGCTGGCTTAAAGCTGTTGTATTGTACACTACTTCTATAGGGAGTCATAATATAACTA
                      ____________________________________________________________
consensus TCTGCTGGCTTAAAGCTGTTGTATTGTACACTACTTCTATAGGGAGTCATAATATAACTA