Previous Contig 009800:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034B10Sequence231001522 (2)pir|T47344|T473440.030hypothetical protein F18P9.20 - Arabidopsis thaliana>gb:ATF18P9_1549257 Arabidop742009800 (3)gb:AB102903_15263505e-28Solanum melongena 5D09 mRNA for hypothetical protein, partial cds.
JMSF017O18Sequence713009800 (3)gb:AB102903_15263504e-27Solanum melongena 5D09 mRNA for hypothetical protein, partial cds.
JMSF040O18Sequence591001522 (2)856009800 (3)gb:AB102903_15263506e-28Solanum melongena 5D09 mRNA for hypothetical protein, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040O18+ AGTCAACAACATTCCATTAT
                      ____________________________________________________________
consensus AGTCAACAACATTCCATTAT
 
. : . : . : . : . : . :
rJMSF040O18+ CAAAGACCAGCATCATCCTTATGAAGCATCATCAAGATCAGGGTTTGGATTAGTCTGCTC
                      ____________________________________________________________
consensus CAAAGACCAGCATCATCCTTATGAAGCATCATCAAGATCAGGGTTTGGATTAGTCTGCTC
 
. : . : . : . : . : . :
rJMSF017O18+ GCTATAGTACTACTCATGA
rJMSF040O18+ CAACCNTCTGCTAAATCCTTTGAGTAAAGGCGGCTCTTCAAGCTATAGTACTACTCATGA
rJMFF034B10+ GCTATAGTACTACTCATGA
                      ____________________________________________________________
consensus CAACCNTCTGCTAAATCCTTTGAGTAAAGGCGGCTCTTCAAGCTATAGTACTACTCATGA
 
. : . : . : . : . : . :
rJMSF017O18+ AGATGTGAGTGATCGTGAGAGCAAAACCCGCCATTCACTTCATCAGTTCATGGATGATTG
rJMSF040O18+ AGATGTGAGTGATCGTGAGAGCAAAACCCGCCATTCACTTCATCAGTTCATGGATGATTG
rJMFF034B10+ AGATGTGAGTGATCGTGAGAGCAAAACCCGCCATTCACTTCATCAGTTCATGGATGATTG
                      ____________________________________________________________
consensus AGATGTGAGTGATCGTGAGAGCAAAACCCGCCATTCACTTCATCAGTTCATGGATGATTG
 
. : . : . : . : . : . :
rJMSF017O18+ GCCCAAGAACCAGCCAGATATCGATCTCCAATCAGATCAAACTCGCCTCTCCATCTCCAT
rJMSF040O18+ GCCCAAGAACCAGCCAGATATCGATCTCCAATCAGATCAAACTCGCCTCTCCATCTCCAT
rJMFF034B10+ GCCCAAGAACCAGCCAGATATCGATCTCCAATCAGATCAAACTCGCCTCTCCATCTCCAT
                      ____________________________________________________________
consensus GCCCAAGAACCAGCCAGATATCGATCTCCAATCAGATCAAACTCGCCTCTCCATCTCCAT
 
. : . : . : . : . : . :
rJMSF017O18+ ACCAATGTCCACTTCAGACTTCATGTCTTCAACGTCGTCTCCAGTGTCTGAGAAGCTTGC
rJMSF040O18+ ACCAATGTCCACTTCAGACTTCATGTCTTCAACGTCGTCTCCAGTGTCTGAGAAGCTTGC
rJMFF034B10+ ACCAATGTCCACTTCAGACTTCATGTCTTCAACGTCGTCTCCAGTGTCTGAGAAGCTTGC
                      ____________________________________________________________
consensus ACCAATGTCCACTTCAGACTTCATGTCTTCAACGTCGTCTCCAGTGTCTGAGAAGCTTGC
 
. : . : . : . : . : . :
rJMSF017O18+ AGCTTCCCCGCTGAAACTATCGTGGGAGCACGAAACCACCACCC-AAATGGGGTTAGGAG
rJMSF040O18+ AGCTTCCCCGCTGAAACTATCGTGGGAGCACGAAACCACCACCC-AAATGGGGTTAGGAG
rJMFF034B10+ AGCTTCCCCGCTGAAACTATCGTGGGAGCACGAAACCACCACCCAAAATGGGGTTAGGAG
                      ____________________________________________________________
consensus AGCTTCCCCGCTGAAACTATCGTGGGAGCACGAAACCACCACCC-AAATGGGGTTAGGAG
 
. : . : . : . : . : . :
rJMSF017O18+ TGGGGGCGGTTATCAACCAAAGACAAGGAAACTGGATTCCCATAGCGTGGGAATCATCAT
rJMSF040O18+ TGGGGGCGGTTATCAACCAAAGACAAGGAAACTGGATTCCCATAGCGTGGGAATCATCAT
rJMFF034B10+ TGGGGGCGGTTATCAACCAAAGACAAGGAAACTGGATTCCCATAGCGTGGGAATCATCAT
                      ____________________________________________________________
consensus TGGGGGCGGTTATCAACCAAAGACAAGGAAACTGGATTCCCATAGCGTGGGAATCATCAT
 
. : . : . : . : . : . :
rJMSF017O18+ CTGTGGGTGGACCTCTGGGCGAGGTTTTTCACAGCACTAACAGTAAGTCATCAGGTGACT
rJMSF040O18+ CTGTGGGTGGACCTCTGGGCGAGGTTTTTCACAGCACTAACAGTAAGTCATCAGGTGACT
rJMFF034B10+ CTGTGGGTGGACCTCTGGGCGAGGTTTTTCACAGCACTAACAGTAAGTCATCAGGTGACT
                      ____________________________________________________________
consensus CTGTGGGTGGACCTCTGGGCGAGGTTTTTCACAGCACTAACAGTAAGTCATCAGGTGACT
 
. : . : . : . : . : . :
rJMSF017O18+ GCAAAAACGCCTCGGCCCCTCTTAACTTCATGGAGGGATGGGATGGGAGTCCAAGAATGG
rJMSF040O18+ GCAAAAACGCCTCGGCCCCTCTTAACCTCATGGAGGGATGGGATGGGAGTCCAAGAATGG
rJMFF034B10+ GCAAAAACGCCTCGGCCCCTCTTAACCTCATGGAGGGATGGGATGGGAGTCCAAGAATGG
                      ____________________________________________________________
consensus GCAAAAACGCCTCGGCCCCTCTTAACCTCATGGAGGGATGGGATGGGAGTCCAAGAATGG
 
. : . : . : . : . : . :
rJMSF017O18+ CTTCATCCCCGACTGGGGTTTTGCAGAAGGCGGCGTTCTGTTCACACTNGAATAGCAGTG
rJMSF040O18+ CTTCATCCCCGACTGGGGTTTTGCAGAAGGCGGCGTTCTGTTCACACTCGAATAGCAGTG
rJMFF034B10+ CTTCATCCCCGACTGGGGTTTTGCAGAAGGCGGCGTTCTGTTCACACTCGAATAGCAGTG
                      ____________________________________________________________
consensus CTTCATCCCCGACTGGGGTTTTGCAGAAGGCGGCGTTCTGTTCACACTCGAATAGCAGTG
 
. : . : . : . : . : . :
rJMSF017O18+ CAGGGAGCAGTCCGAGAGCTGAGAATAACAGTGTTATGAACCCATCCCTGCAAGCTCTGT
rJMSF040O18+ CAGGGAGCAGTCCGAGAGCTGAGAATAACAGTGTTATGAACCCATCCCTGCAAGCTCTGT
rJMFF034B10+ CAGGGAGCAGTCCGAGAGCTGAGAATAACAGTGTTATGAACCCATCCCTGCAAGCTCTGT
                      ____________________________________________________________
consensus CAGGGAGCAGTCCGAGAGCTGAGAATAACAGTGTTATGAACCCATCCCTGCAAGCTCTGT
 
. : . : . : . : . : . :
rJMSF017O18+ AGCCCTGAAGCAAGAAGATGAAGATCATCATCAGTATTAATCTAGCTTTTTTCCAGTTAA
rJMSF040O18+ AGCCCTGAAGCAAGAAGATGAAGATCATCATCAGTATTAATCTAGCTTTTTTCCAGTTAA
rJMFF034B10+ AGCCCTGAAGCAAGAAGATGAAGATCATCATCAGTATTAATCTAGCTTTTTTCCAGTTAA
                      ____________________________________________________________
consensus AGCCCTGAAGCAAGAAGATGAAGATCATCATCAGTATTAATCTAGCTTTTTTCCAGTTAA
 
. : . : . : . : . : . :
rJMSF017O18+ GATTTGTTAATTTGATTGCTTGTGTAATATTTTCAGCCTTGAGAACACATAGCTTGTGTA
rJMSF040O18+ GATTTGTTAATTTGATTGCTTGTGTAATATTTTCAGCCTTGAGAACACATAGCTTGTGTA
rJMFF034B10+ GATTTGTTAATTTGATTGCTTGTGTAATATTTTCAGCCTTGAGAACACATAGCTTGTGTA
                      ____________________________________________________________
consensus GATTTGTTAATTTGATTGCTTGTGTAATATTTTCAGCCTTGAGAACACATAGCTTGTGTA
 
. : . : . : . : . : . :
rJMSF017O18+ ATAGCCGAGTAAATGCCTAAATGGCATCCATCAGA
rJMSF040O18+ ATAGCCGAGTAAATGCCTAAATGGCATCCATCAGACTTCAAGTTTAGATTTTTGCTC
rJMFF034B10+ ATAGCCGAGTAAATGCCTAAATGGCATCCATCAGACTTCAAGTTTAGATTTTTGCTCTAA
                      ____________________________________________________________
consensus ATAGCCGAGTAAATGCCTAAATGGCATCCATCAGACTTCAAGTTTAGATTTTTGCTCTAA