Previous Contig 009798:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003B13Sequence580009798 (8)sp|P32289|GLNA_VIGAC4e-91Glutamine synthetase nodule isozyme (EC 6.3.1.2) (Glutamate--ammonia ligase) (GS732009798 (8)sp|P14656|GLN3_ORYSAe-114Glutamine synthetase shoot isozyme (EC 6.3.1.2) (Glutamate--ammonia ligase) (Clo
JMFF006I04Sequence576009798 (8)sp|P32289|GLNA_VIGAC1e-88Glutamine synthetase nodule isozyme (EC 6.3.1.2) (Glutamate--ammonia ligase) (GS788009798 (8)sp|P14656|GLN3_ORYSAe-123Glutamine synthetase shoot isozyme (EC 6.3.1.2) (Glutamate--ammonia ligase) (Clo
JMFF011L14Sequence411009798 (8)sp|P32289|GLNA_VIGAC7e-55Glutamine synthetase nodule isozyme (EC 6.3.1.2) (Glutamate--ammonia ligase) (GS761009798 (8)sp|P14656|GLN3_ORYSAe-107Glutamine synthetase shoot isozyme (EC 6.3.1.2) (Glutamate--ammonia ligase) (Clo
JMFF034B04Sequence532014740gb:AF480497_18037591e-10Oryza sativa clone BAC 24K23, complete sequence.678009798 (8)sp|P14656|GLN3_ORYSA6e-95Glutamine synthetase shoot isozyme (EC 6.3.1.2) (Glutamate--ammonia ligase) (Clo
JMSF010O22Sequence252009798 (8)sp|P51118|GLN1_VITVI2e-31Glutamine synthetase cytosolic isozyme 1 (EC 6.3.1.2) (Glutamate-- ammonia ligas

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF006I04- ATAAATCCTAGACTT
JMFF011L14- AGACTT
JMFF003B13- AGACTT
                      ____________________________________________________________
consensus ATAAATCCTAGACTT
 
. : . : . : . : . : . :
JMFF006I04- GTTTCAACCTCTGTGCCGTGTTCTTATTGATCGAGTAGAGTAGAGAAAGATCATGGCTTT
JMFF011L14- GTTTCAACCTCTGTGCCGTGTTCTTATTGATCGAGTAGAGTAGAGAAAGATCATGGCTTT
JMFF003B13- GTTTCAACCTCTGTGCCGTGTTCTTATTGATCGAGTAGAGTAGAGAAAGATCATGGCTTT
                      ____________________________________________________________
consensus GTTTCAACCTCTGTGCCGTGTTCTTATTGATCGAGTAGAGTAGAGAAAGATCATGGCTTT
 
. : . : . : . : . : . :
JMFF006I04- GCTTTCTGATTTGATCAACCTTGATCTCTCCGAAACCACCGACAAAATCATTGTTGAATA
JMFF011L14- GCTTTCTGATTTGATCAACCTTGATCTCTCCGAAACCACCGACAAAATCATTGTTGAATA
JMFF003B13- GCTTTCTGATTTGATCAACCTTGATCTCTCCGAAACCACCGACAAAATCATTGTTGAATA
                      ____________________________________________________________
consensus GCTTTCTGATTTGATCAACCTTGATCTCTCCGAAACCACCGACAAAATCATTGTTGAATA
 
. : . : . : . : . : . :
JMFF006I04- CATATGGATTGATGGAACTGGTTTGGGCCTGAGGAGCAAAGCCAGGACCATTCCTAAGGC
JMFF011L14- CATATGGATTGATGGAACTGGTTTGGGCCTGAGGAGCAAAGCCAGGACCATTCCTAAGGC
JMFF003B13- CATATGGATTGATGGAACTGGTTTGGGCCTGAGGAGCAAAGCCAGGACCATTCCTAAGGC
                      ____________________________________________________________
consensus CATATGGATTGATGGAACTGGTTTGGGCCTGAGGAGCAAAGCCAGGACCATTCCTAAGGC
 
. : . : . : . : . : . :
JMFF006I04- TGTAAAAGACCCTTCTGAGCTTCCAAAGTGGAACTATGATGGTTCTAGCACTGGCCAAGC
JMFF011L14- TGTAAAAGACCCTTCTGAGCTTCCAAAGTGGAACTATGATGGTTCTAGCACTGGCCAAGC
JMFF003B13- TGTAAAAGACCCTTCTGAGCTTCCAAAGTGGAACTATGATGGTTCTAGCACTGGCCAAGC
                      ____________________________________________________________
consensus TGTAAAAGACCCTTCTGAGCTTCCAAAGTGGAACTATGATGGTTCTAGCACTGGCCAAGC
 
. : . : . : . : . : . :
JMFF006I04- TCCGGGAGAGGACAGTGAAGTCATCCTATATCCTCAGGCAATATTCAGGGACCCTTTTAG
JMFF011L14- TCCGGGAGAGGACAGTGAAGTCATCCTATATCCTCAGGCAATATTCAGGGACCCTTTTAG
JMFF003B13- TCCGGGAGAGGACAGTGAAGTCATCCTATATCCTCAGGCAATATTCAGGGACCCTTTTAG
                      ____________________________________________________________
consensus TCCGGGAGAGGACAGTGAAGTCATCCTATATCCTCAGGCAATATTCAGGGACCCTTTTAG
 
. : . : . : . : . : . :
JMFF006I04- AAGAGGCAACAATATTCTTGTGATGTGTGATGCTTATACTCCAGCAGGTGAGCCTCTCCC
JMFF011L14- AAGAGGCAACAATATTCTTGTGATGTGTGATGCTTATACTCCAGCAGGTGAGCCTCTCCC
JMFF003B13- AAGAGGCAACAATATTCTTGTGATGTGTGATGCTTATACTCCAGCAGGTGAGCCTCTCCC
                      ____________________________________________________________
consensus AAGAGGCAACAATATTCTTGTGATGTGTGATGCTTATACTCCAGCAGGTGAGCCTCTCCC
 
. : . : . : . : . : . :
JMFF006I04- AACAAACAAGAGATATAATGCAGCAAAAATATTTAACCATCCAGATGTTGTTGCTGAAGA
JMFF011L14- AACAAACAAGAGATATAATGCAGCAAAAATATTTAACCATCCAGA
JMFF003B13- AACAAACAAGAGATATAATGCAGCAAAAATATTTAACCATCCAGATGTTGTTGCTGAAGA
                      ____________________________________________________________
consensus AACAAACAAGAGATATAATGCAGCAAAAATATTTAACCATCCAGATGTTGTTGCTGAAGA
 
. : . : . : . : . : . :
JMFF006I04- GCCATGGTATGGAATAGAGCAAGAGTATACTCTGTTGCAGAAAGATGTGAAATGGCCACT
JMFF003B13- GCCATGGTATGGAATAGAGCAAGAGTATACTCTGTTGCAGAAAGATGTGAAATGGCCACT
rJMFF006I04+ TGGAATAGAGCAAGAGTATACTCTGTTGCAGAAAGATGTGAAATGNCCACT
rJMFF011L14+ GTGAAATGNCCACT
                      ____________________________________________________________
consensus GCCATGGTATGGAATAGAGCAAGAGTATACTCTGTTGCAGAAAGATGTGAAATGGCCACT
 
. : . : . : . : . : . :
JMFF006I04- TGGTTGGCCTGTGGGAGGATTT-CCAGGGCCTCAGGGACCGTACTATTGTGGAATTGGTG
JMFF003B13- TGGTTGGCCTGTGGGAGGATTT-CCAGGGCCTCAGGGACCGTACTATTGTGGAATTGGTG
rJMFF006I04+ TGGTTGGCCTGTGGGAGGATTTCCCAGGGCCTCAGGGACCGTACTATTGTGGAATTGGTG
rJMFF003B13+ GCCTGTGGGAGGATTT-CCAGGGCNTCAGGGACCGTACTATTGTGGAATTGGTG
rJMFF011L14+ TGGTTGNCCTGTGGGAGGATTT-CCAGGGCCTCAGGGACCGTACTATTGTGGAATTGGTG
                      ____________________________________________________________
consensus TGGTTGGCCTGTGGGAGGATTT-CCAGGGCCTCAGGGACCGTACTATTGTGGAATTGGTG
 
. : . : . : . : . : . :
JMFF006I04- CAGACAAGGCTTTTGGGAGGGA
JMFF003B13- CAGACAAGGCTTTTGGGAGGGACATTGTGGACTCT
rJMFF006I04+ CAGACAAGGCTTTTGGGAGGGACATTGTGGACTCTCACTATAAGGCCTGTTTGTATGCTG
rJMFF003B13+ CAGACAAGGCTTTTGGGAGGGACATTGTGGACTCTCACTATAAGGCCTGTTTGTATGCTG
rJMFF011L14+ CAGACAAGGCTTTTGGGAGGGACATTGTGGACTCTCACTATAAGGCCTGTTTGTATGCTG
rJMFF034B04+ AGGCCTGTTTGTATGCTG
                      ____________________________________________________________
consensus CAGACAAGGCTTTTGGGAGGGACATTGTGGACTCTCACTATAAGGCCTGTTTGTATGCTG
 
. : . : . : . : . : . :
rJMFF006I04+ GTATTAACATCAGTGGCATCAATGGTGAAGTTATGCCCGGACAGTGGGAGTTTCAAGTCG
rJMFF003B13+ GTATTAACATCAGTGGCATCAATGGTGAAGTTATGCCCGGACAGTGGGAGTTTCAAGTCG
rJMFF011L14+ GTATTAACATCAGTGGCATCAATGGTGAAGTTATGCCCGGACAGTGGGAGTTTCAAGTCG
rJMFF034B04+ GTATTAACATCAGTGGCATCAATGGTGAAGTTATGCCCGGACAGTGGGAGTTTCAAGTCG
                      ____________________________________________________________
consensus GTATTAACATCAGTGGCATCAATGGTGAAGTTATGCCCGGACAGTGGGAGTTTCAAGTCG
 
. : . : . : . : . : . :
rJMFF006I04+ GTCCATCTGTCGGAATCAGTGCTGGTGATGAAGTCTGGGTGGCACGTTACATTCTAGAGA
JMSF010O22- AGA
rJMFF003B13+ GTCCATCTGTCGGAATCAGTGCTGATGATGAAGTCTGGGTGGCACGTTACATTCTAGAGA
rJMFF011L14+ GTCCATCTGTCGGAATCAGTGCTGATGATGAAGTCTGGGTGGCACGTTACATTCTAGAGA
rJMFF034B04+ GTCCATCTGTCGGAATCAGTGCTGGTGATGAAGTCTGGGTGGCACGTTACATTCTAGAGA
                      ____________________________________________________________
consensus GTCCATCTGTCGGAATCAGTGCTGGTGATGAAGTCTGGGTGGCACGTTACATTCTAGAGA
 
. : . : . : . : . : . :
rJMFF006I04+ GGATTACTGAGATAGCTGGAGTGGTTCTCTCCTTTGATCCCAAACCCATTCCGGGCGATT
JMSF010O22- GGATTACTGAGATAGCTGGAGTGGTTCTCTCCTTTGATCCCAAACCCATTCCGGGCGATT
rJMFF003B13+ GGATTACTGAGATAGCTGGAGTGGTTCTCTCCTTTGATCCCAAACCCATTCCGGGCGATT
rJMFF011L14+ GGATTACTGAGATAGCTGGAGTGGTTCTCTCCTTTGATCCCAAACCCATTCCGGGCGATT
rJMFF034B04+ GGATTACTGAGATAGCTGGAGTGGTTCTCTCCTTTGATCCCAAACCCATTCCAGGCGATT
                      ____________________________________________________________
consensus GGATTACTGAGATAGCTGGAGTGGTTCTCTCCTTTGATCCCAAACCCATTCCGGGCGATT
 
. : . : . : . : . : . :
rJMFF006I04+ GGAATGGAGCTGGTGCACATACAAATTACAGCACAAAGTCGATGAGGAATGATGGAGGTT
JMSF010O22- GGAATGGAGCTGGTGCACATACAAATTACAGCACAAAGTCGATGAGGAATGATGGAGGTT
rJMFF003B13+ GGAATGGAGCTGGTGCACATACAAATTACAGCACAAAGTCGATGAGGAATGATGGAGGTT
rJMFF011L14+ GGAATGGAGCTGGTGCACATACAAATTACAGCACAAAGTCGATGAGGAATGATGGAGGTT
rJMFF034B04+ GGAATGGAGCTGGTGCACATACAAATTACAGCACAAAGTCGATGAGGAATGATGGAGGTT
                      ____________________________________________________________
consensus GGAATGGAGCTGGTGCACATACAAATTACAGCACAAAGTCGATGAGGAATGATGGAGGTT
 
. : . : . : . : . : . :
rJMFF006I04+ TTGAAGTGATAAAGAAGGCAATCTCAAAACTGGAGCTGAAGCACAAGGAACACATTGCTG
JMSF010O22- TTGAAGTGATAAAGAAGGCAATCTCAAAACTGGAGCTGAAGCACAAGGAACACATTGCTG
rJMFF003B13+ TTGAAGTGATAAAGAAGGCAATCTCAAAACTGGAGCTGAAGCACAAGGAACACATTGCTG
rJMFF011L14+ TTGAAGTGATAAAGAAGGCAATCTCAAAACTGGAGCTGAAGCACAAGGAACACATTGCTG
rJMFF034B04+ TTGAAGTGATAAAGAAGGCAATCTCAAAACTGGAGCTGAAGCACAAGGAACACATTGCTG
                      ____________________________________________________________
consensus TTGAAGTGATAAAGAAGGCAATCTCAAAACTGGAGCTGAAGCACAAGGAACACATTGCTG
 
. : . : . : . : . : . :
rJMFF006I04+ CTTATGGCGAAGGCAATGAACGTCGCCTCACCGGAAGGCATGAAACTGCTAATATCCATA
JMSF010O22- CTTATGGCGAAGGCAATGAACGTCG
rJMFF003B13+ CTTATGGCGAAGGCAATGAACGTCGCCTCACCGGAAGGCATGAAACTGCTAATATCCATA
rJMFF011L14+ CTTATGGCGAAGGCAATGAACGTCGCCTCACCGGAAGGCATGAAACTGCTAATATCCATA
rJMFF034B04+ CTTATGGCGAAGGCAATGAACGTCGCCTCACCGGAAGGCATGAAACTGCTAATATCCATA
                      ____________________________________________________________
consensus CTTATGGCGAAGGCAATGAACGTCGCCTCACCGGAAGGCATGAAACTGCTAATATCCATA
 
. : . : . : . : . : . :
rJMFF006I04+ AATTCTCATGGGGTGTGGCAAATCGTGGAGCCTCGGTTAGGGTTGGCAGAGACACGGAGA
rJMFF003B13+ AATTCTCATGGGGTGTGGCAAATCGTGGAGCCTCGGTTAGGGTTGGCAGAGACACGGAGA
rJMFF011L14+ AATTCTCATGGGGTGTGGCAAATCGTGGAGCCTCGGTTAGGGTTGGCAGAGACACGGAGA
rJMFF034B04+ AATTCTCATGGGGTGTGGCAAATCGTGGAGCCTCGGTTAGGGTTGGCAGAGACACGGAGA
                      ____________________________________________________________
consensus AATTCTCATGGGGTGTGGCAAATCGTGGAGCCTCGGTTAGGGTTGGCAGAGACACGGAGA
 
. : . : . : . : . : . :
rJMFF006I04+ AAGAGGGCAAGGGCTATTTTGAGGATAGGAGACCTGCGTCGAATATGGATCCTTACGTGG
rJMFF003B13+ AAGAGGGCAAGGGCTATTTTGAGGATAGGAGACCTGCGTCGAATATGGATCCTTACGTGG
rJMFF011L14+ AAGAGGGCAAGGGCTATTTTGAGGATAGGAGACCTGCGTCGAATATGGATCCTTACGTGG
rJMFF034B04+ AAGAGGGCAAGGGCTATTTTGAGGATAGGAGACCTGCGTCGAATATGGATCCTTACGTGG
                      ____________________________________________________________
consensus AAGAGGGCAAGGGCTATTTTGAGGATAGGAGACCTGCGTCGAATATGGATCCTTACGTGG
 
. : . : . : . : . : . :
rJMFF006I04+ TTACTTCTATGGTCGCAGAAACAACTATTATCTGGAAGCCATGAAAGGATTGAACTTGAA
rJMFF003B13+ TTACTTCTATGGTCGCAGAAACAACTATTATCTGGAAGCCATGAAAGGATTGAACTTGAA
rJMFF011L14+ TTACTTCTATGGTCGCAGAAACAACTATTATCTGGAAGCCATGAAAGGATTGAACTTGAA
rJMFF034B04+ TTACTTCTATGGTCGCAGAAACAACTATTATCTGGAAGCCATGAAAGGATTGAACTTGAA
                      ____________________________________________________________
consensus TTACTTCTATGGTCGCAGAAACAACTATTATCTGGAAGCCATGAAAGGATTGAACTTGAA
 
. : . : . : . : . : . :
rJMFF006I04+ GTTGTATTTTACTACTACATACCCTACCTTGCATTTCTATTCTAAAATGCTATTGTTTCA
rJMFF003B13+ GTTGTATTTTACTACTACATACCCTACCTTGCATTTCTATTCTAAAATGCTATTGTTTCA
rJMFF011L14+ GTTGTATTTTACTACTACATACCCTACCTTGCATTTCTATTCTAAAATGCTATTGTTTCA
rJMFF034B04+ GTTGTATTTTACTACTACATACCCTACCTTGCATTTCTATTCTAAAATGCTATTGTTTCA
                      ____________________________________________________________
consensus GTTGTATTTTACTACTACATACCCTACCTTGCATTTCTATTCTAAAATGCTATTGTTTCA
 
. : . : . : . : . : . :
rJMFF006I04+ CATTGATTTGGCATGTT
rJMFF003B13+ CATTGATTTGGCATGTT
rJMFF011L14+ CATTGATTTGGCATGTTATTTTTCTTAA
rJMFF034B04+ CATTGATTTGGCATGTTATTTTTCTTAAATGGAATTATGGTTGTAAGGGTTCAAGAATTG
                      ____________________________________________________________
consensus CATTGATTTGGCATGTTATTTTTCTTAAATGGAATTATGGTTGTAAGGGTTCAAGAATTG