Previous Contig 009797:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034A24Sequence508006751 (2)pir|C86275|C862759e-32hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890407 Arabid740009797 (2)gb:AC151803_17451235e-16Solanum demissum chromosome 5 BAC PGEC979H09 genomic sequence, complete sequence
JMSF043D10Sequence818007533 (2)gb:AC154033_1745263e-101Solanum demissum chromosome 5 clone PGEC132D05 map MAP_LOC, complete sequence.790009797 (2)gb:AC151803_17451231e-42Solanum demissum chromosome 5 BAC PGEC979H09 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF043D10+ CGGATGCCTTATAGGGAAAGGTGGTTCCATCATTAGTGAGATGAGAAA
                      ____________________________________________________________
consensus CGGATGCCTTATAGGGAAAGGTGGTTCCATCATTAGTGAGATGAGAAA
 
. : . : . : . : . : . :
rJMSF043D10+ TACCACGAGGGCGGGTATTCGAATCCTAGCCAAGGAAAATCTACCCAAAGTTGCATCTGA
rJMFF034A24+ CTACCCAAAGTTGCATCTGA
                      ____________________________________________________________
consensus TACCACGAGGGCGGGTATTCGAATCCTAGCCAAGGAAAATCTACCCAAAGTTGCATCTGA
 
. : . : . : . : . : . :
rJMSF043D10+ AGATGATGAGATGGTGCAGATTACTGGAGAGCTCAATGTTGCTAGCACTGCATTGTT-CC
rJMFF034A24+ AGATGATGAGATGGTGCAGATTACTGGAGAGCTCAATGTTGCTAGCACTGCATTGTTNCC
                      ____________________________________________________________
consensus AGATGATGAGATGGTGCAGATTACTGGAGAGCTCAATGTTGCTAGCACTGCATTGTTNCC
 
. : . : . : . : . : . :
rJMSF043D10+ AAATAGTTTTGCGCTTGAGGGCAAATGTTTTTGAGATGGAAGGAACTTTAGCTGCAATTT
rJMFF034A24+ AAATAGTTTTGCGCTTGAGGGCAAATGTTTTTGAGATGGAAGGAACTTTAGCTGCAATTT
                      ____________________________________________________________
consensus AAATAGTTTTGCGCTTGAGGGCAAATGTTTTTGAGATGGAAGGAACTTTAGCTGCAATTT
 
. : . : . : . : . : . :
rJMSF043D10+ CACCAGTTCTTCCATATGGTGGAGTGCCTCCCAACATCTCAGAAGGTTCAAAGTATTCCA
rJMFF034A24+ CACCAGTTCTTCCATATGGTGGAGTGCCTCCCAACATCTCAGAAGGTTCAAAGTATTCCA
                      ____________________________________________________________
consensus CACCAGTTCTTCCATATGGTGGAGTGCCTCCCAACATCTCAGAAGGTTCAAAGTATTCCA
 
. : . : . : . : . : . :
rJMSF043D10+ ATCGTGATAATAAATCACGTAGCCATGGGCATCCAATGTATTCTGGTGTACGTGATTTTG
rJMFF034A24+ ATCGTGATAATAAATCACGTAGCCATGGGCATCCAATGTATTCTGGTGTACGTGATTTTG
                      ____________________________________________________________
consensus ATCGTGATAATAAATCACGTAGCCATGGGCATCCAATGTATTCTGGTGTACGTGATTTTG
 
. : . : . : . : . : . :
rJMSF043D10+ AGGATTCACTTCCAAATGATAGTTATGGTGGTTCACAGATTGGTGGCGGAAGTAGTTATG
rJMFF034A24+ AGGATTCACTTCCAAATGATAGTTATGGTGGTTCACAGATTGGTGGCGGAAGTAGTTATG
                      ____________________________________________________________
consensus AGGATTCACTTCCAAATGATAGTTATGGTGGTTCACAGATTGGTGGCGGAAGTAGTTATG
 
. : . : . : . : . : . :
rJMSF043D10+ GACCTTATGGAGTTTACTCCTCTAGCCGTTCTAATAGTGCAGGGTTAGCTAGCCATAACC
rJMFF034A24+ GACCTTATGGAGTTTACTCCTCTAGCCGTTCTAATAGTGCAGGGTTAGCTAGCCATAACC
                      ____________________________________________________________
consensus GACCTTATGGAGTTTACTCCTCTAGCCGTTCTAATAGTGCAGGGTTAGCTAGCCATAACC
 
. : . : . : . : . : . :
rJMSF043D10+ CTGTATCTTATGGCAAGTCTAATGGTTTCTAGAGTTCTTGGGTGTGAGGGCTACAGCTCT
rJMFF034A24+ CTGTATCTTATGGCAAGTCTAATGGTTTCTAGAGTTCTTGGGTGTGAGGGCTACAGCTCT
                      ____________________________________________________________
consensus CTGTATCTTATGGCAAGTCTAATGGTTTCTAGAGTTCTTGGGTGTGAGGGCTACAGCTCT
 
. : . : . : . : . : . :
rJMSF043D10+ GGTCCATGATGCCTGAGTCAGCCCATGCCCCTTTTGGTGCAGCCTAAGAACAGAAGATGA
rJMFF034A24+ GGTCCATGATGCCTGAGTCAGCCCATGCCCCTTTTGGTGCAGTCTAAGAACAGAAGATGA
                      ____________________________________________________________
consensus GGTCCATGATGCCTGAGTCAGCCCATGCCCCTTTTGGTGCAGTCTAAGAACAGAAGATGA
 
. : . : . : . : . : . :
rJMSF043D10+ ACAGGATACAGAAAGTTGTGGTTGTCTTGCCCATAGCATTGTTGGTTTTTAGGAGTTGTG
rJMFF034A24+ ACAGGATACAGAAAGTTGTGGTTGTCTTGCCCATAGCATTGTTGGTTTTTAGGAGTTGTG
                      ____________________________________________________________
consensus ACAGGATACAGAAAGTTGTGGTTGTCTTGCCCATAGCATTGTTGGTTTTTAGGAGTTGTG
 
. : . : . : . : . : . :
rJMSF043D10+ GTCATCTTGCCCAGTTTTATACTTTTATATTGTAATGAAACATTTTATCTGGTTGTTTGT
rJMFF034A24+ GTCATCTTGCCCAGTTTTATACTTTTATATTGTAATGAAACATTTTATCTGGTTGTTTGT
                      ____________________________________________________________
consensus GTCATCTTGCCCAGTTTTATACTTTTATATTGTAATGAAACATTTTATCTGGTTGTTTGT
 
. : . : . : . : . : . :
rJMSF043D10+ GGCCTTGTACCTGATACCTTTAGGTTCTTTGGTTTCATAAACCAGTGCCAAAGCATTTAC
rJMFF034A24+ GGCCTTGTACCTGATACCTTTAGGTTCTTTGGTTTCATAAACCAGTGCCAAAGCATTTAC
                      ____________________________________________________________
consensus GGCCTTGTACCTGATACCTTTAGGTTCTTTGGTTTCATAAACCAGTGCCAAAGCATTTAC
 
. : . : . : . : . : . :
rJMSF043D10+ GTGTAATTTAGCACTAC
rJMFF034A24+ GTGTAATTTAGCACTACCTTGATCGTCTTTTTTAATTCTTTNGAATCTTATGCAAGTCGT
                      ____________________________________________________________
consensus GTGTAATTTAGCACTACCTTGATCGTCTTTTTTAATTCTTTNGAATCTTATGCAAGTCGT