Previous Contig 009794:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005D18Sequence438004773 (5)gb:AY065020_15661835e-34Arabidopsis thaliana At1g72120/F28P5_2 mRNA, complete cds.>gb:BT001020_1635275 A737009794 (6)pir|F86358|F863586e-57Similar to peptide transporter [imported] - Arabidopsis thaliana>gb:AE005172_891
JMFF020P15Sequence454004773 (5)gb:AY065020_15661834e-33Arabidopsis thaliana At1g72120/F28P5_2 mRNA, complete cds.>gb:BT001020_1635275 A724009794 (6)pir|F86358|F863583e-49Similar to peptide transporter [imported] - Arabidopsis thaliana>gb:AE005172_891
JMFF033P19Sequence757009794 (6)pir|F86358|F863581e-54Similar to peptide transporter [imported] - Arabidopsis thaliana>gb:AE005172_891
JMSF007B24Sequence612009794 (6)pir|F86358|F863582e-34Similar to peptide transporter [imported] - Arabidopsis thaliana>gb:AE005172_891
JMSF038J24Sequence715004773 (5)pir|F86358|F863582e-67Similar to peptide transporter [imported] - Arabidopsis thaliana>gb:AE005172_891800009794 (6)pir|F86358|F863586e-65Similar to peptide transporter [imported] - Arabidopsis thaliana>gb:AE005172_891
JMSF046P20Sequence719004773 (5)pir|F86358|F863582e-66Similar to peptide transporter [imported] - Arabidopsis thaliana>gb:AE005172_891661009794 (6)pir|F86358|F863587e-40Similar to peptide transporter [imported] - Arabidopsis thaliana>gb:AE005172_891

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038J24+ AC
                      ____________________________________________________________
consensus AC
 
. : . : . : . : . : . :
rJMSF038J24+ GAAGCAAGGAGCTACGATGAATAGATCTATTGGTTCGAATCTTCAAATACCCCCTTCTAC
                      ____________________________________________________________
consensus GAAGCAAGGAGCTACGATGAATAGATCTATTGGTTCGAATCTTCAAATACCCCCTTCTAC
 
. : . : . : . : . : . :
rJMSF038J24+ ACTCCAAACTTTCATTAGCCTTTCTGTTGTCATCTTTATCCCTATATACGACTGCATTTT
rJMFF005D18+ ACTTTCATTAGCCTTTCTGTTGTCATCTTTATCCCTATATACGACTGCATTTT
rJMFF020P15+ CTGCATTTT
rJMFF033P19+ TCTGTNGTCATCTTTATCCCTATATACGACTGCATTTT
                      ____________________________________________________________
consensus ACTCCAAACTTTCATTAGCCTTTCTGTTGTCATCTTTATCCCTATATACGACTGCATTTT
 
. : . : . : . : . : . :
rJMSF038J24+ TGTTCCCGTTACACGAGCTGTAACTGGAAAGCCCTCGGGAATAACAATGCTTCAAAGAAT
rJMFF005D18+ TGTTCCCGTTACACGAGCTGTAACTGGAAAGCCCTCGGGAATAACAATGCTTCAAAGAAT
rJMSF046P20+ GGGAATAACAATGCTTCAAAGAA-
rJMFF020P15+ NGTTCCCGTTACACGAGCTGTAACTGGAAAGCCCTCGGGAATAACAATGCTTCAAAGAAT
rJMFF033P19+ TGTTCCCGTTACACGAGCTGTAACTGGAAAGCCNTCGGGAATAACAATGCTTCAAAGAAT
                      ____________________________________________________________
consensus TGTTCCCGTTACACGAGCTGTAACTGGAAAGCCCTCGGGAATAACAATGCTTCAAAGAAT
 
. : . : . : . : . : . :
rJMSF038J24+ TGGAACGGGAATCCTTTTATCTGTCGTCTCTATGGTGATTGCAGCTATAGTAGAACAGCA
rJMFF005D18+ TGGAACGGGAATCCTTTTATCTGTCGTCTCTATGGTGATTGCAGCTATAGTAGAACAGCA
rJMSF046P20+ TNGAACGGGAATCCTTTTATCNGTCGTCTCTATGGTGATTGCAGCTATAGTAGATCAGCA
rJMSF007B24+ TCTCTANGGTGATTGCAGCTATAGTAGAACAGCA
rJMFF020P15+ TGGAACGGGAATCCTTTTATCTGTCGTCTCTATGGTGATTGCAGCTATAGTAGAACAGCA
rJMFF033P19+ TGGAACGGGAATCCTTTTATCTGTCGTCTCTATGGTGATTGCAGCTATAGTAGAACAGCA
                      ____________________________________________________________
consensus TGGAACGGGAATCCTTTTATCTGTCGTCTCTATGGTGATTGCAGCTATAGTAGAACAGCA
 
. : . : . : . : . : . :
rJMSF038J24+ ACGTCTTCAAATTGCTTCGGACCACGGGTTAATTGACAAGCCCGATGCAACGGTTCCCAT
rJMFF005D18+ ACGTCTTCAAATTGCTTCGGACCACGGGTTAATTGACAAGCCCGATGCAACGGTTCCCAT
rJMSF046P20+ ACGTCTTCAAATTGCTTCGGACCACGGGTTAATTGACAAGCCCGATGCAACGGTTCCCAT
rJMSF007B24+ ACGTCTTCAAATTGCTTCGGACCACGGGTTAATTGACAAGCCCGATGCAACGGTTCCCAT
rJMFF020P15+ ACGTCTTCAAATTGCTTCGGACCACGGGTTAATTGACAAGCCCGATGCAACGGTTCCCAT
rJMFF033P19+ ACGTCTTCAAATTGCTTCGGACCACGGGTTAATTGACAAGCCCGATGCAACGGTTCCCAT
                      ____________________________________________________________
consensus ACGTCTTCAAATTGCTTCGGACCACGGGTTAATTGACAAGCCCGATGCAACGGTTCCCAT
 
. : . : . : . : . : . :
rJMSF038J24+ GAGCGTGTGGTGGCTAATACCCCAGTACGCATTGTTTGGCATTTCAGATGTATTCACCAT
rJMFF005D18+ GAGCGTGTGGTGGCTAATACCCCAGTACGCATTGTTTGGCATTTCAGATGTATTCACCAT
rJMSF046P20+ GAGCGTGTGGTGGCTAATACCCCAGTACGCATTGTTTGGCATTTCAGATGTATTCACCAT
rJMSF007B24+ GAGCGTGTGGTGGCTAATACCCCAGTACGCATTGTTTGGCATNTCAGATGTATTCACCAT
rJMFF020P15+ GAGCGTGTGGTGGCTAATACCCCAGTACGCATTGTTTGGCATTTCAGATGTATTCACCAT
rJMFF033P19+ GAGCGTGTGGTGGCTAATACCCCAGTACGCATTGTTTGGCATTTCAGATGTATTCACCAT
                      ____________________________________________________________
consensus GAGCGTGTGGTGGCTAATACCCCAGTACGCATTGTTTGGCATTTCAGATGTATTCACCAT
 
. : . : . : . : . : . :
rJMSF038J24+ GGTCGGGCTACAAGAGTTTTTCTACGATCAGGTGCCCAAGGAGCTGAAAAGCATAGGTCT
rJMFF005D18+ GGTCGGGCTACAAGAGTTTTTCTACGATCAGGTGCCCAAGGAGCTGAAAAGCATAGGTCT
rJMSF046P20+ GGTCGGGCTACAAGAGTTTTTCTACGATCAGGTGCCCAAGGAGCTGAAAAGCATAGGTCT
rJMSF007B24+ GGTCGGGNTACAAGAGTTTTTCTACGATCAGGNGCCCAAGGAGCTGAAAAGCATAGGTCT
rJMFF020P15+ GGTCGGGCTACAAGAGTTTTTCTACGATCAGGTGCCCAAGGAGCTGAAAAGCATAGGTCT
rJMFF033P19+ GGTCGGGCTACAAGAGTTTTTCTACGATCAGGTGCCCAAGGAGCTGAAAAGCATAGGTCT
                      ____________________________________________________________
consensus GGTCGGGCTACAAGAGTTTTTCTACGATCAGGTGCCCAAGGAGCTGAAAAGCATAGGTCT
 
. : . : . : . : . : . :
rJMSF038J24+ CGCTTTGTACCTCAGTATATTTGGCATCGGGAGCTTCTTGAGCAGCTTTCTCATCTCTAT
rJMFF005D18+ CGCTTTGTACCTCAGTATATTTGGCATCGGGAGCTTCTTGAGCAGCTTTCTCATCTCTAT
rJMSF046P20+ CGCTTTGTACCTCAGTATATTTGGCATCGGGAGCTTCTTGAGCAGCTTTCTCATCTCTAT
rJMSF007B24+ CGCTTTGTACCTCAGTATATTTGGCATCGGGAGCTTCTTGAGCAGCTTTCTCATCTCTAT
rJMFF020P15+ CGCTTTGTACCTCAGTATATTTGGCATCGGGAGCTTCTTGAGCAGCTTTCTCATCTCTAT
rJMFF033P19+ CGCTTTGTACCTCAGTATATTTGGCATCGGGAGCTTCTTGAGCAGCTTTCTCATCTCTAT
                      ____________________________________________________________
consensus CGCTTTGTACCTCAGTATATTTGGCATCGGGAGCTTCTTGAGCAGCTTTCTCATCTCTAT
 
. : . : . : . : . : . :
rJMSF038J24+ CATCGAGCAAGCCACCGGTAAAGATGGCGGAGACAGTTGGTTTTCTGACAACTTGAACAG
rJMFF005D18+ CATCGAGCAAGCCACCGGTAAAGATGGCGGAGACAGTTGGTTTTCTGACAACTTGAACAG
rJMSF046P20+ CATCGAGCAAGCCACCGGTAAAGATGGCGGAGACAGTTGGTTTTCTGACAACTTGAACAG
rJMSF007B24+ CATCGAGCAAGCCACCGGTAAAGATGGCGGAGACAGTTGGTTNTCTGACAACTTGAACAG
rJMFF020P15+ CATCGAGCAAGCCACCGGTAAAGATGGCGGAGACAGTTGGTTTTCTGACAACTTGAACAG
rJMFF033P19+ CATCGAGCAAGCCACCGGTAAAGATGGCGGAGACAGTTGGTTTTCTGACAACTTGAACAG
                      ____________________________________________________________
consensus CATCGAGCAAGCCACCGGTAAAGATGGCGGAGACAGTTGGTTTTCTGACAACTTGAACAG
 
. : . : . : . : . : . :
rJMSF038J24+ GGCGCATCTTGACTACTTCTACTGGCTCCTCGCCGGACTTTCTGCACTTTCATTGCTTGC
rJMFF005D18+ GGCGCATCTTGACTACTTCTACTGGCTCCTCGCCGGACTTTCTGCACTTTCATTGCTTGC
rJMSF046P20+ GGCGCATCTTGACTACTTCTACTGGCTCCTCGCCGGACTTTCTGCACTTTCATTGCTTGC
rJMSF007B24+ GGCGCATCTTGACTACTTCTACTGGCTCCTCGCCGGACTTTCTGCACTTTCATTGCTTGC
rJMFF020P15+ GGCGCATCTTGACTACTTCTACTGGCTCCTCGCCGGACTTTCTGCACTTTCATTGCTTGC
rJMFF033P19+ GGCGCATCTTGACTACTTCTACTGGCTCCTCGCCGGACTTTCTGCACTTTCATTGCTTGC
                      ____________________________________________________________
consensus GGCGCATCTTGACTACTTCTACTGGCTCCTCGCCGGACTTTCTGCACTTTCATTGCTTGC
 
. : . : . : . : . : . :
rJMSF038J24+ ATACTTGTATTTTTCAAGATCTTATGTCTACAACAAAGCCATTGTGATATAAAATGCTTG
rJMFF005D18+ ATACTTGTATTTTTCAAGATCTTATGTCTACAACAAAGCCATTGTGATATAAAATGCTTG
rJMSF046P20+ ATACTTGTATTTTTCAAGATCTTATGTCTACAACAAAGCCATTGTGATATAAAATGCTTG
rJMSF007B24+ ATACTTGTATTTTTCAAGATCNTATGTCTACAACAAAGCCATTGTGATATAAAATGCTTG
rJMFF020P15+ ATACTTGTATTTTTCAAGATCTTATGTCTACAACAAAGCCATTGTGATATAAAATGCTTG
rJMFF033P19+ ATACTTGTATTTTTCAAGATCTTATGTCTACAACAAAGCCATTGTGATATAAAATGCTTG
                      ____________________________________________________________
consensus ATACTTGTATTTTTCAAGATCTTATGTCTACAACAAAGCCATTGTGATATAAAATGCTTG
 
. : . : . : . : . : . :
rJMSF038J24+ GGCAATCTTTGTACTATCTTGAACTTGTAATGTATTAGTTATGCCATTTTATGAACTTGT
rJMFF005D18+ GGCAATCTTTGTACTATCTTGAACTTGTAATGTATTAGTTATGCCATTTTATGAACTTGT
rJMSF046P20+ GGCAATCTTTGTACTATCTTGAACTTGTAATGTATTAGTTATGCCATTTTATGAACTTGT
rJMSF007B24+ GGCAATCTTTGTACTATCTTGAACTTGTAATGTATTAGTTATGCCATTTTATGAACTTGT
rJMFF020P15+ GGCAATCTTTGTACTATCTTGAACTTGTAATGTATTAGTTATGCCATTTTATGAACTTGT
rJMFF033P19+ GGCAATCTTTGTACTATCTTGAACTTGTAATGTATTAGTTATGCCATTTTATGAACTTGT
                      ____________________________________________________________
consensus GGCAATCTTTGTACTATCTTGAACTTGTAATGTATTAGTTATGCCATTTTATGAACTTGT
 
. : . : . : . : . : . :
rJMSF038J24+ AAGTATTAATTAATGTACTAATCAGTATGCTTGGACGATTATATTGTAGGTTCATATGTA
rJMFF005D18+ AAGTATTAATTAATGTACTAATCAGTATGCTTGGACGATTATATTGTAGGTTCATATGTA
rJMSF046P20+ AAGTATTAATTAATGTACTAATCAGTATGCTTGGACGATTATATTGTAGGTTCATATGTA
rJMSF007B24+ AAGTATTAATTAATGTACTAATCAGTANGCTTGGACGATTATATNGTAGGTTCATANGNA
rJMFF020P15+ AAGTATTAATTAATGTACTAATCAGTATGCTTGGACGATTATATTGTAGGTTCATATGTA
rJMFF033P19+ AAGTATTAATTAATGTACTAATCAGTATGCTTGGACGATTATATTGTAGGTTCATATGTA
                      ____________________________________________________________
consensus AAGTATTAATTAATGTACTAATCAGTATGCTTGGACGATTATATTGTAGGTTCATATGTA
 
. : . : . : . : . : . :
rJMSF038J24+ ATTTTGGATATTGTGGTT
rJMFF005D18+ ATTTTGGATATTGTGGT-TTATGAT
rJMSF046P20+ ATTTTGGATATTGTGGT-TTATGATTTGTGAGCTTGAT
rJMSF007B24+ ATTTCGGATATTGTGGTCTTATGATTTGTGAGCTTGAT
rJMFF020P15+ ATTTTGGATATTGTGGT-TTATGATTTGTGAGCTTGATTATCTACTTGTATTAATA
rJMFF033P19+ ATTTTGGATATTGTGGT-TTATGATTTGTGAGCTTGATTATCTACTTGTATTAATATGTT
                      ____________________________________________________________
consensus ATTTTGGATATTGTGGT-TTATGATTTGTGAGCTTGATTATCTACTTGTATTAATATGTT