Previous Contig 009791:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002M12Sequence467009791 (24)gb:AY195602_15888694e-28Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.682009791 (24)gb:AY195602_15888692e-34Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.
JMFF009D22Sequence477009791 (24)gb:AY195602_15888692e-27Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.711009791 (24)gb:AY195602_15888695e-37Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.
JMFF028N10Sequence471009791 (24)gb:AY195602_15888692e-27Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.709009791 (24)gb:AY195602_15888695e-37Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.
JMFF033O13Sequence473009791 (24)gb:AY195602_15888696e-29Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.737009791 (24)gb:AY195602_15888696e-37Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.
JMFF044H05Sequence636009791 (24)gb:AY195602_15888694e-37Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.539009791 (24)gb:AY195602_15888699e-20Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.
JMFF047G13Sequence455009791 (24)gb:AY195602_15888695e-32Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.390009791 (24)gb:AY195602_15888690.002Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.
JMFF050N06Sequence623009791 (24)gb:AY195602_15888694e-37Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.538009791 (24)gb:AY195602_15888699e-20Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.
JMFN001H05Sequence536009791 (24)gb:AY195602_15888692e-28Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.
JMFN007D23Sequence597009791 (24)gb:AY195602_15888694e-37Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.
JMFN009B07Sequence604009791 (24)gb:AY195602_15888692e-26Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.
JMFN010O22Sequence616009791 (24)gb:AY195602_15888694e-37Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.
JMFN011N13Sequence644009791 (24)gb:AY195602_15888692e-26Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.
JMFN015G08Sequence642009791 (24)gb:AY195602_15888692e-41Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.
JMFN033A01Sequence621009791 (24)gb:AY195602_15888693e-36Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.
JMFN045M21Sequence604009791 (24)gb:AY195602_15888694e-37Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.
JMSF037P09Sequence664009791 (24)gb:AY195602_15888692e-36Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.702009791 (24)gb:AY195602_15888695e-37Nicotiana tabacum early tobacco anther 1 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF002M12- TAATTCA
rJMFF044H05- GATTCATAATTCA
rJMFF050N06- GATTCATAATTCA
JMFN009B07+ GATTCATAATTCA
rJMFF047G13- GATTCATAATTCA
rJMFF009D22- GCAGCTGTCAATTAGATTCATAATTCA
rJMFF028N10- TAGATTCATAATTCA
                      ____________________________________________________________
consensus GCAGCTGTCAATTAGATTCATAATTCA
 
. : . : . : . : . : . :
JMFN001H05+ GTTTCATTAAGCCAACT
rJMFF002M12- AATGTCCATTTTAGTCAAAACTACAAAAGCAACAGCATTGACGGTTTCATTAAGCCAACT
JMFN033A01+ GGTTTCATTAAGCCAACT
rJMFF044H05- AATGTCCATTTTAGTCAAAACTACAAAAGCAACAGCATTGACGGTTTCATTAAGCCAACT
rJMFF050N06- AATGTCCATTTTAGTCAAAACTACAAAAGCAACAGCATTGACGGTTTCATTAAGCCAACT
JMFN009B07+ AATGTCCATTTTAGTCAAAACTACAAAAGCAACAGCATTGACGGTTTCATTAAGCCAACT
rJMFF047G13- AATGTCCATTTTAGTCAAAACTACAAAAGCAACAGCATTGACGGTTTCATTAAGCCAACT
rJMFF009D22- AATGTCCATTTTAGTCAAAACTACAAAAGCAACAGCATTGACGGTTTCATTAAGCCAACT
rJMFF028N10- AATGTCCATTTTAGTCAAAACTACAAAAGCAACAGCATTGACGGTTTCATTAAGCCAACT
rJMSF037P09- TGTCCATTTTAGTCAAAACTACAAAAGCAACAGCATTGACGGTTTCATTAAGCCAACT
rJMFF033O13- GACGGTTTC-TTAAGCCAACT
                      ____________________________________________________________
consensus AATGTCCATTTTAGTCAAAACTACAAAAGCAACAGCATTGACGGTTTCATTAAGCCAACT
 
. : . : . : . : . : . :
JMFN001H05+ AAAGCACTAACCACTAACGGGTTATACTGTGTACCACTACTAGTCAACAGGGTAAATTAG
rJMFF002M12- AAAGCACTAACCACTAACGGGTTATACTGTGTACCACTACTAGTCAACAGGGTAAATTAG
JMFN033A01+ AAAGCACTAACCACTAACGGGTTATACTGTGTACCACTACTAGTCAACAGGGTAAATTAG
rJMFF044H05- AAAGCACTAACCACTAACGGGTTATACTGTGTACCACTACTAGTCAACAGGGTAAATTAG
rJMFF050N06- AAAGCACTAACCACTAACGGGTTATACTGTGTACCACTACTAGTCAACAGGGTAAATTAG
JMFN009B07+ AAAGCACTAACCACTAACGGGTTATACTGTGTACCACTACTAGTCAACAGGGTAAATTAG
rJMFF047G13- AAAGCACTAACCACTAACGGGTTATACTGTGTACCACTACTAGTCAACAGGGTAAATTAG
rJMFF009D22- AAAGCACTAACCACTAACGGGTTATACTGTGTACCACTACTAGTCAACAGGGTAAATTAG
rJMFF028N10- AAAGCACTAACCACTAACGGGTTATACTGTGTACCACTACTAGTCAACAGGGTAAATTAG
rJMSF037P09- AAAGCACTAACCACTAACGGGTTATACTGTGTACCACTACTAGTCAACAGGGTAAATTAG
JMSF037P09+ AGTCAACAGGGTAAATTAG
JMFN015G08+ AGGGTAAATTAG
JMFN045M21+ ACAGGGTAAATTAG
JMFN011N13+ AATTAG
rJMFF033O13- AAAGCACTAACCACTAACGGGTTATACTGTGTACCACTACTAGTCAACAGGGTAAATTAG
                      ____________________________________________________________
consensus AAAGCACTAACCACTAACGGGTTATACTGTGTACCACTACTAGTCAACAGGGTAAATTAG
 
. : . : . : . : . : . :
JMFN001H05+ GGACAACAATAAGAGTAAAGTAACAGGGAACTTTGAGATCC-AACGGCCTTCATGCCTCC
rJMFF002M12- GGACAACAATAAGAGTAAAGTAACAGGGAACTTTGAGATCC-AACGGCCTTCATGCCTCC
JMFN033A01+ GGACAACAATAAGAGTAAAGTAACAGGGAACTTTGAGATCC-AACGGCCTTCATGCCTCC
rJMFF044H05- GGACAACAATAAGAGTAAAGTAACAGGGAACTTTGAGATCC-AACGGCCTTCATGCCTCC
rJMFF050N06- GGACAACAATAAGAGTAAAGTAACAGGGAACTTTGAGATCC-AACGGCCTTCATGCCTCC
JMFN009B07+ GGACAACAATAAGAGTAAAGTAACAGGGAACTTTGAGATCC-AACGGCCTTCATGCCTCC
rJMFF047G13- GGACAACAATAAGAGTAAAGTAACAGGGAACTTTGAGATCC-AACGGCCTTCATGCCTCC
rJMFF009D22- GGACAACAATAAGAGTAAAGTAACAGGGAACTTTGAGATCC-AACGGCCTTCATGCCTCC
rJMFF028N10- GGACAACAATAAGAGTAAAGTAACAGGGAACTTTGAGATCC-AACGGCCTTCATGCCTCC
rJMSF037P09- GGACAACAATAAGAGTAAAGTAACAGGGAACTTTGAGATCC-AACGGCCTTCATGCCTCC
JMSF037P09+ GGACAACAATAAGAGTAAAGTAACAGGGAACTTTGAGATCC-AACGGCCTTCATGCCTCC
JMFN015G08+ GGACAACAATAAGAGTAAAGTAACAGGGAACTTTGAGATCC-AACGGCCTTCATGCCTCC
JMFF050N06+ TAAGAGTAAAGTAACAGGGACCT-TGAGATCC-AACGGCCTTCATGCCTCC
JMFF044H05+ AATAAGAGTAAAGTAACAGGGAACT-TGAGATCC-AACGGCCTTCATGCCTCC
JMFN010O22+ TAAGAGTAAAGTAACAGGGAACTNTGAGATCC-AACGGCCTTCATGCCTCC
JMFN045M21+ GGACAACAATAAGAGTAAAGTAACAGGGAACTTTGAGATCC-AACGGCCTTCATGCCTCC
JMFN007D23+ GTAAAGTAACAGGGAACTTGGAGATCCAAAGGGCCTTCATGCCTCC
JMFN011N13+ GGACTACAATGAGAGTATAGTATCAGGGGGCTTTGAGATCC-AACGGCCTGCATGCCTCC
rJMFF033O13- GGACAACAATAAGAGTAAAGTAACAGGGAACTTTGAGATCC-AACGGCCTTCATGCCTCC
                      ____________________________________________________________
consensus GGACAACAATAAGAGTAAAGTAACAGGGAACTTTGAGATCC-AACGGCCTTCATGCCTCC
 
. : . : . : . : . : . :
JMFN001H05+ ACGTCAGCGCAATTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
rJMFF002M12- ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
JMFN033A01+ ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
rJMFF044H05- ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
rJMFF050N06- ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
JMFN009B07+ ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
rJMFF047G13- ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
rJMFF009D22- ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
rJMFF028N10- ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
rJMSF037P09- ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
JMSF037P09+ ACGTCAGCGCACTTTTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
JMFN015G08+ ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
JMFF050N06+ ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
JMFF044H05+ ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
JMFN010O22+ ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
JMFN045M21+ ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
JMFN007D23+ ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
JMFN011N13+ TCGTCAGCGAGCTTATTCGCCGGGGAGCAAATCAACCATCCGTTGCCATGCGGGTCCTTC
rJMFF033O13- ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
                      ____________________________________________________________
consensus ACGTCAGCGCACTTCTTCGCCGGGGAGCAAATCAACCATACGTTGCCATACGGGTCCTTC
 
. : . : . : . : . : . :
JMFN001H05+ ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
rJMFF002M12- ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
JMFN033A01+ ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
rJMFF044H05- ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
rJMFF050N06- ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
JMFN009B07+ ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
rJMFF047G13- ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
rJMFF009D22- ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
rJMFF028N10- ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
rJMSF037P09- ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
JMSF037P09+ ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
JMFN015G08+ ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACTGTCG
JMFF050N06+ ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
JMFF044H05+ ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
JMFN010O22+ ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
JMFN045M21+ ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
JMFN007D23+ ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
JMFF033O13+ CACCGTCG
JMFF028N10+ CCGTCG
JMFF002M12+ CG
JMFF009D22+ ACCGTCG
JMFN011N13+ ACCTTGAGCACGCGTCTGCCGCAGCATGCATATTCTCCACCCTGACCAATGTGACGGTAG
rJMFF033O13- ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
                      ____________________________________________________________
consensus ACCTTGCCCACGCGACCGCCGCAGCACGCATCTTCACCACCCTCACCAATCTCACCGTCG
 
. : . : . : . : . : . :
JMFN001H05+ GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
rJMFF002M12- GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
JMFN033A01+ GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
rJMFF044H05- GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
rJMFF050N06- GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
JMFN009B07+ GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
rJMFF047G13- GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTC
rJMFF009D22- GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
rJMFF028N10- GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
rJMSF037P09- GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
JMSF037P09+ GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
JMFN015G08+ GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
JMFF050N06+ GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
JMFF044H05+ GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
JMFN010O22+ GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
JMFN045M21+ GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
JMFN007D23+ GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
JMFF033O13+ GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATNGACGTCCTCGGTCTCCAGA
JMFF028N10+ GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
JMFF002M12+ GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
JMFF009D22+ GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
JMFF047G13+ CAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
JMFN011N13+ TCGACAGGGCAGGCAGTCCCAGCGTTAGCACCAGCAGCATCGACGTCTTCGGTCTGCAGG
rJMFF033O13- GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
                      ____________________________________________________________
consensus GCGACAGCGCCGGCAGTCACAGCGTTAGCAACAGCAGCATCGACGTCCTCGGTCTCCAGA
 
. : . : . : . : . : . :
JMFN001H05+ CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
rJMFF002M12- CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
JMFN033A01+ CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
rJMFF044H05- CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
rJMFF050N06- CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
JMFN009B07+ CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
rJMFF009D22- CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
rJMFF028N10- CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
rJMSF037P09- CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
JMSF037P09+ CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
JMFN015G08+ CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
JMFF050N06+ CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
JMFF044H05+ CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
JMFN010O22+ CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
JMFN045M21+ CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
JMFN007D23+ CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
JMFF033O13+ CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
JMFF028N10+ CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
JMFF002M12+ CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
JMFF009D22+ CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
JMFF047G13+ CAGTGAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
JMFN011N13+ CAGTGCATGCCGGCGGTCAAGCCTCCCTGGCCAGGAGCAGAGGAGTCCTCAGTTAGGTCA
rJMFF033O13- CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
                      ____________________________________________________________
consensus CAGTAAACGCCGGCGGTCAAGCCTCCCTTGACAGGAGCAGAGGAGTCCTCAGTTAGGTCA
 
. : . : . : . : . : . :
JMFN001H05+ GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
rJMFF002M12- GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
JMFN033A01+ GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
rJMFF044H05- GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
rJMFF050N06- GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
JMFN009B07+ GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
rJMFF009D22- GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
rJMFF028N10- GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
rJMSF037P09- GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
JMSF037P09+ GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
JMFN015G08+ GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
JMFF050N06+ GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
JMFF044H05+ GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
JMFN010O22+ GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
JMFN045M21+ GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
JMFN007D23+ GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
JMFF033O13+ GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
JMFF028N10+ GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
JMFF002M12+ GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
JMFF009D22+ GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
JMFF047G13+ GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
JMFN011N13+ GGAACGAGGGACTCGGTGGAGCCGAGCTTAAGTTCAGCAGATAGAATGAGAGGCTGTTCC
rJMFF033O13- GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
                      ____________________________________________________________
consensus GAAACGAGGAACACGGTGGAACCGAGCTTAAGTTCAGCAGAGAGAATGAGAGGCTGTTCC
 
. : . : . : . : . : . :
JMFN001H05+ TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
rJMFF002M12- TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
JMFN033A01+ TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
rJMFF044H05- TGTTCAGCCTTCCTCTTGGGG
rJMFF050N06- TGTTCAGCCTTCCTCTTGGG
JMFN009B07+ TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
rJMFF009D22- TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
rJMFF028N10- TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
rJMSF037P09- TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
JMSF037P09+ TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
JMFN015G08+ TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
JMFF050N06+ TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
JMFF044H05+ TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
JMFN010O22+ TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
JMFN045M21+ TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
JMFN007D23+ TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
JMFF033O13+ TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
JMFF028N10+ TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
JMFF002M12+ TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
JMFF009D22+ TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
JMFF047G13+ TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
JMFN011N13+ TGTTGAGCCTTCCTCGTGGGGTGCATGAGGCGGCTGACCTCCCCGGCTACAAACGCCGCG
rJMFF033O13- TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
                      ____________________________________________________________
consensus TGTTCAGCCTTCCTCTTGGGGTGCATGACACGGCTGACCTCCTCGGCACCAAACGCCGCC
 
. : . : . : . : . : . :
JMFN001H05+ TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCA
rJMFF002M12- TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
JMFN033A01+ TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
JMFN009B07+ TTATAGAACAGGACGGCGTCGTTTCC
rJMFF009D22- TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
rJMFF028N10- TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
rJMSF037P09- TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
JMSF037P09+ TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
JMFN015G08+ TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
JMFF050N06+ TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
JMFF044H05+ TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
JMFN010O22+ TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
JMFN045M21+ TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
JMFN007D23+ TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
JMFF033O13+ TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
JMFF028N10+ TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
JMFF002M12+ TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
JMFF009D22+ TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
JMFF047G13+ TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
JMFN011N13+ TTATAGATCAGGTCGGCGTCGTTTCCCTTAGGTGCCTCCTCAAAGAGGTGAGGTTTCAGA
rJMFF033O13- TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
                      ____________________________________________________________
consensus TTATAGAACAGGACGGCGTCGTTTCCCTTCGGCGCCTCCACGAAGAGCTGAGGCTTCAGA
 
. : . : . : . : . : . :
rJMFF002M12- GCAGTGAACTTCACA-ACCTTAGGGGGAACCATTCTCGCTCCCACCGTTCTGAGCATCCT
JMFN033A01+ GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTCTGAGCATCCT
rJMFF009D22- GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTCTGAGCATCCT
rJMFF028N10- GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTCTGAGCATCCT
rJMSF037P09- GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTCTGAGCATCCT
JMSF037P09+ GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTNTGAGCATCCT
JMFN015G08+ GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTCTGAGCATCCT
JMFF050N06+ GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTCTGAGCATCCT
JMFF044H05+ GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTCTGAGCATCCT
JMFN010O22+ GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTCTGAGCATCCT
JMFN045M21+ GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTCTGAGCATCCT
JMFN007D23+ GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTCTGAGCATCCT
JMFF033O13+ GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTCTGAGCATCCT
JMFF028N10+ GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTNTGAGCATCCT
JMFF002M12+ GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTNTGAGCATCCT
JMFF009D22+ GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTNTGAGCATCCT
JMFF047G13+ GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTCTGAGCATCCT
JMFN011N13+ CCAGTGAGCTTCCCATACCTTA-GGGGACCCATTCTAGCTTCCTCCGTTGTGAGCATCCT
rJMFF033O13- GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTCTGAGCATCCT
                      ____________________________________________________________
consensus GCAGTGAACTTCACA-ACCTTA-GGGGAACCATTCTCGCTCCCACCGTTCTGAGCATCCT
 
. : . : . : . : . : . :
rJMFF002M12- GAGCCGCCATCACTCAC
JMFN033A01+ GAGCCG
rJMFF009D22- GAGCCGCCATCACTCACCACCGGCAGA
rJMFF028N10- GAGCCGCCATCACTCACCACCGGCAGAGAGAAACAGA
rJMSF037P09- GAGCCGCCATCACTCACCACCGGCAGAGAGAAACAGAACANGGAGAT
JMSF037P09+ GAGCCGCCATCACTCACCACCGGCAGAGAGAAACAGAACAAGGAGATAGTGAAGAAAGCT
JMFN015G08+ GAGCCGCCATCACTCACCACCGGCAGAGAGAAACAGAACAAGGAGATAGTGAAGAAAGCT
JMFF050N06+ GAGCCGCCATCACTCACCACCGGCAGAGAGAAACAGAACAAGGAGATAGTGAAGAAAGCT
JMFF044H05+ GAGCCGCCATCACTCACCACCGGCAGAGAGAAACAGAACAAGGAGATAGTGAAGAAAGCT
JMFN010O22+ GAGCCGCCATCACTCACCACCGGCAGAGAGAAACAGAACAAGGAGATAGTGAAGAAAGCT
JMFN045M21+ GAGCCGCCATCACTCACCACCGGCAGAGAGAAACAGAACAAGGAGATAGTGAA
JMFN007D23+ GAGCCGCCATCACTCACCACCGGCTGAGAGAAACAGAACAAGGAGATAGTGAAGAAAGCT
JMFF033O13+ GAGCCGCCATCACTCACCACCGGCAGAGAGAAACAGAACAAGGAGATAGTGAAGAAAGCT
JMFF028N10+ GAGCCGCCATCACTCACCACCGGCAGAGAGAAACAGAACAAGGAGATAGTGAAGAAAGCT
JMFF002M12+ GAGCCGCCATCACTCACCACCGGCAGAGAGAAACAGAACAAGGAGATAGTGAAGAAAGCT
JMFF009D22+ GAGCCGCCATCACTCACCACCGGCAGAGAGAAACAGAACAAGGAGATAGTGAAGAAAGCT
JMFF047G13+ GAGCCGCCATCACTCACCACCGGCAGAGAGAAACAGAACAAGGAGATAGTGAAGAAAGCT
JMFN011N13+ GAGCCGCCATCACTCACCACCGGCAGAGAGTAGCAGAGCAAGCAGATAGTGAAGCAAGCT
rJMFF033O13- GAGCCGCCATCACTCACCACCGGCAGAGAGAAACAGAACAAGGAGATAGTGAAGAAAGCT
                      ____________________________________________________________
consensus GAGCCGCCATCACTCACCACCGGCAGAGAGAAACAGAACAAGGAGATAGTGAAGAAAGCT
 
. : . : . : . : . : . :
JMSF037P09+ TTAAAAATGGCAGAAAAAAAAAGGAGAAATCAGAAAGGGATAAAAGC
JMFN015G08+ TTAAAAATGGCAGAAAAAAAAAGGAGAAATCAG
JMFF050N06+ TTAAAAATGGCAGAAAAAAAAAGGAGAAATCAGAAA
JMFF044H05+ TTAAAAATGGCAGAAAAAAAAAGGAGAAATCAGAAAGGGATAAAAGC
JMFN010O22+ TTAAAAATGGCAGAAAAAAAAAGGAGAA
JMFN007D23+ TTAAAAATGGCAG
JMFF033O13+ TTAAAAATGGCAGAAAAAAAAAGGAGAAATCAGAAAGGGATAAAAGC
JMFF028N10+ TTAAAAATGGCAGAAAAAAAAAGGAGAAATCAGAAAGGGATAAAAGC
JMFF002M12+ TTAAAAATGGCAGAAAAAAAAAGGAGAAATCAGAAAGGGATAAAAGC
JMFF009D22+ TTAAAAATGGCAGAAAAAAAAAGGAGAAATCAGAAAGGGATAAAAGC
JMFF047G13+ TTAAAAATGGCAGAAAAAAAAAGGAGAAATCAGAAAGGGATAAAAGC
JMFN011N13+ TTAAA
rJMFF033O13- TTAAAAATGGCAGAAAAAAAAAGGAGAAATCANAAAGGGATAAAAGCCGGTTCTCGACGA
                      ____________________________________________________________
consensus TTAAAAATGGCAGAAAAAAAAAGGAGAAATCAGAAAGGGATAAAAGCCGGTTCTCGACGA