Previous Contig 009790:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006I20Sequence552009790 (7)761009790 (7)gb:AY050468_15622422e-33Arabidopsis thaliana AT3g56130/F18O21_90 mRNA, complete cds.>gb:AF378871_1793456
JMFF033O12Sequence752009790 (7)gb:AY050468_15622422e-33Arabidopsis thaliana AT3g56130/F18O21_90 mRNA, complete cds.>gb:AF378871_1793456
JMFF035D18Sequence576009790 (7)gb:AY050468_15622425e-09Arabidopsis thaliana AT3g56130/F18O21_90 mRNA, complete cds.>gb:AF378871_1793456702009790 (7)gb:AY050468_15622422e-33Arabidopsis thaliana AT3g56130/F18O21_90 mRNA, complete cds.>gb:AF378871_1793456
JMSF007D22Sequence326009790 (7)793009790 (7)gb:AY050468_15622427e-38Arabidopsis thaliana AT3g56130/F18O21_90 mRNA, complete cds.>gb:AF378871_1793456

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF006I20- GAATCTATA
                      ____________________________________________________________
consensus GAATCTATA
 
. : . : . : . : . : . :
JMFF006I20- GCGAGACGAGACGAGCGCACGTTAGCAGGGAGCCAAGGGACAGCATACGGTTAGGAGAGT
                      ____________________________________________________________
consensus GCGAGACGAGACGAGCGCACGTTAGCAGGGAGCCAAGGGACAGCATACGGTTAGGAGAGT
 
. : . : . : . : . : . :
JMFF006I20- GGGTGAAGAAAGAAATGAGAGTGACGGACATTTCAAAGCAGTGCTTCAGATTCTCTTTGT
                      ____________________________________________________________
consensus GGGTGAAGAAAGAAATGAGAGTGACGGACATTTCAAAGCAGTGCTTCAGATTCTCTTTGT
 
. : . : . : . : . : . :
JMFF006I20- TTTCACAGCTATCTTGCGTGCTATAAAGTTCCTTTCCATATCTCTTCTCTAAACCTCATT
                      ____________________________________________________________
consensus TTTCACAGCTATCTTGCGTGCTATAAAGTTCCTTTCCATATCTCTTCTCTAAACCTCATT
 
. : . : . : . : . : . :
JMSF007D22- AAGTCCTAACTTCCCGGAGAGATCTGCATTTCTTTCTCCGCCGATGGAGTCAG
JMFF006I20- TATTCCTAAGTCCTAACTTCCCGGAGAGATCTGCATTTCTTTCTCCGCCGATGGAGTCAG
JMFF035D18- AAGTCCTAACTTCCCGGAGAGATCTGCATTTCTTTCTCCGCCGATGGAGTCAG
                      ____________________________________________________________
consensus TATTCCTAAGTCCTAACTTCCCGGAGAGATCTGCATTTCTTTCTCCGCCGATGGAGTCAG
 
. : . : . : . : . : . :
JMSF007D22- CCGCCATTCTCCGCTCCCCCCACCATTGTGTTGGTAATTCTCACCTGAAGTCGATATTGG
JMFF006I20- CCGCCATTCTCCGCTCCCCCCACCATTGTGTTGGTAATTCTCACCTGAAGTCGATATTGG
JMFF035D18- CCGCCATTCTCCGCTCCCCCCACCATTGTGTTGGTAATTCTCACCTGAAGTCGATATTGG
                      ____________________________________________________________
consensus CCGCCATTCTCCGCTCCCCCCACCATTGTGTTGGTAATTCTCACCTGAAGTCGATATTGG
 
. : . : . : . : . : . :
JMSF007D22- ATATGGCTGGTGTGGTTCCCATGAATAGTGCTGCATTCTCCAACAGAAGTGGCTTGACAT
JMFF006I20- ATATGGCTGGTGTGGTTCCCATGAATAGTGCTGCATTCTCCAACAGAAGTGGCTTGACAT
JMFF035D18- ATATGGCTGGTGTGGTTCCCATGAATAGTGCTGCATTCTCCAACAGAAGTGGCTTGACAT
                      ____________________________________________________________
consensus ATATGGCTGGTGTGGTTCCCATGAATAGTGCTGCATTCTCCAACAGAAGTGGCTTGACAT
 
. : . : . : . : . : . :
JMSF007D22- TTGGTGGGAAGCTCATTTGTTCGCGAAACAGGCACAACAGATTAGTAATGTCATCTGCAA
JMFF006I20- TTGGTGGGAAGCTCATTTGTTCGCGAAACAGGCACAACAGATTAGTAATGTCATCTGCAA
JMFF035D18- TTGGTGGGAAGCTCATTTGTTCGCGAAACAGGCACAACAGATTAGTAATGTCATCTGCAA
                      ____________________________________________________________
consensus TTGGTGGGAAGCTCATTTGTTCGCGAAACAGGCACAACAGATTAGTAATGTCATCTGCAA
 
. : . : . : . : . : . :
JMSF007D22- AGACACCAGAAACTGTACCAGCAAATTTGAATG
JMFF006I20- AGACACCAGAAACTGTACCAGCAAATTTGAATGGAGCAGCTGTTCTGAGTCATAGCCAAC
JMFF035D18- AGACACCAGAAACTGTACCAGCAAATTTGAATGGAGCAGCTGTTCTGAGTCATAGCCAAC
                      ____________________________________________________________
consensus AGACACCAGAAACTGTACCAGCAAATTTGAATGGAGCAGCTGTTCTGAGTCATAGCCAAC
 
. : . : . : . : . : . :
JMFF006I20- AAACTGTGCCAGATGAGAAGAATTCCCTGACACAAGCTATATTCCCTGATGGTTTTGAGG
JMFF035D18- AAACTGTGCCAGATGAGAAGAATTCCCTGACACAAGCTATATTCCCTGATGGTTTTGAGG
                      ____________________________________________________________
consensus AAACTGTGCCAGATGAGAAGAATTCCCTGACACAAGCTATATTCCCTGATGGTTTTGAGG
 
. : . : . : . : . : . :
JMFF006I20- CCC
JMFF035D18- CCCTAATCACAGAAGTCTGTGATGACACAGAAATTGCTGAGTTGAAACTTAAGGCTGGGG
                      ____________________________________________________________
consensus CCCTAATCACAGAAGTCTGTGATGACACAGAAATTGCTGAGTTGAAACTTAAGGCTGGGG
 
. : . : . : . : . : . :
JMFF035D18- ATTTTGAGATGCACCTATTGCGGAAAATTGAGGCTACAGCAGTCCCAGCGCCAGTTGTCT
                      ____________________________________________________________
consensus ATTTTGAGATGCACCTATTGCGGAAAATTGAGGCTACAGCAGTCCCAGCGCCAGTTGTCT
 
. : . : . : . : . : . :
JMFF035D18- CTCCCACACCACCACCTAGTCCAAGTCAACCAGTGGTTGACTCATTGCCTGCCGCTTCTT
rJMFF006I20+ GTCCAAGTCAACCAGTGGTTGACTCATTGCCTGCCGCTTCTT
rJMFF033O12+ ACCAGTGGTTGACTCATTGCCTGCCGCTTCTT
                      ____________________________________________________________
consensus CTCCCACACCACCACCTAGTCCAAGTCAACCAGTGGTTGACTCATTGCCTGCCGCTTCTT
 
. : . : . : . : . : . :
JMFF035D18- CAGCATCTCCATCAAAACCATCTGAAAAATCTAGCCCATTT
rJMFF035D18+ CCCATTTATAAATGTCTCTTCCGAGA
rJMSF007D22+ CCCATTTATAAATGTCTCTTCCGAGA
rJMFF006I20+ CAGCATCTCCATCAAAACCATCTGAAAAATCTAGCCCATTTATAAATGTCTCTTCCGAGA
rJMFF033O12+ CAGCATCTCCATCAAAACCATCTGAAAAATCTAGCCCATTTATAAATGTCTCTTCCGAGA
                      ____________________________________________________________
consensus CAGCATCTCCATCAAAACCATCTGAAAAATCTAGCCCATTTATAAATGTCTCTTCCGAGA
 
. : . : . : . : . : . :
rJMFF035D18+ AGTCAACAAAGTTAGCTGCACTAGAGGCTTCCGGATCTAGTGGTTATGTCCTAGTATTAT
rJMSF007D22+ AGTCAACAAAGTTAGCTGCACTAGAGGCTTCCGGATCTAGTGGTTATGTCCTAGTATTAT
rJMFF006I20+ AGTCAACAAAGTTAGCTGCACTAGAGGCTTCCGGATCTAGTGGTTATGTCCTAGTATTAT
rJMFF033O12+ AGTCAACAAAGTTAGCTGCACTAGAGGCTTCCGGATCTAGTGGTTATGTCCTAGTATTAT
                      ____________________________________________________________
consensus AGTCAACAAAGTTAGCTGCACTAGAGGCTTCCGGATCTAGTGGTTATGTCCTAGTATTAT
 
. : . : . : . : . : . :
rJMFF035D18+ CTCAAGCTGTTGGCTCGTTTCGAAGGGCTAGAACTTCAAAGGGAAAGAAGCTACCACTTG
rJMSF007D22+ CTCAAGCTGTTGGCTCGTTTCGAAGGGCTAGAACTTCAAAGGGAAAGAAGCTACCACTTG
rJMFF006I20+ CTCAAGCTGTTGGCTCGTTTCGAAGGGCTAGAACTTCAAAGGGAAAGAAGCTACCACTTG
rJMFF033O12+ CTCAAGCTGTTGGCTCGTTTCGAAGGGCTAGAACTTCAAAGGGAAAGAAGCTACCACTTG
                      ____________________________________________________________
consensus CTCAAGCTGTTGGCTCGTTTCGAAGGGCTAGAACTTCAAAGGGAAAGAAGCTACCACTTG
 
. : . : . : . : . : . :
rJMFF035D18+ CTTGCAAGGAGGGCGATATTATAAAAGCAGGACAAACTATTGGCTTTCTGGATCAGTTTG
rJMSF007D22+ CTTGCAAGGAGGGCGATATTATAAAAGCAGGACAAACTATTGGCTTTCTGGATCAGTTTG
rJMFF006I20+ CTTGCAAGGAGGGCGATATTATAAAAGCAGGACAAACTATTGGCTTTCTGGATCAGTTTG
rJMFF033O12+ CTTGCAAGGAGGGCGATATTATAAAAGCAGGACAAACTATTGGCTTTCTGGATCAGTTTG
                      ____________________________________________________________
consensus CTTGCAAGGAGGGCGATATTATAAAAGCAGGACAAACTATTGGCTTTCTGGATCAGTTTG
 
. : . : . : . : . : . :
rJMFF035D18+ GTTCTGAGGTTCCAGTCAAAGCAGATGTGGCTGGAAAAGTCTTGAAGATCCTCTATGATG
rJMSF007D22+ GTTCTGAGGTTCCAGTCAAAGCAGATGTGGCTGGAAAAGTCTTGAAGATCCTCTATGATG
rJMFF006I20+ GTTCTGAGGTTCCAGTCAAAGCAGATGTGGCTGGAAAAGTCTTGAAGATCCTCTATGATG
rJMFF033O12+ GTTCTGAGGTTCCAGTCAAAGCAGATGTGGCTGGAAAAGTCTTGAAGATCCTCTATGATG
                      ____________________________________________________________
consensus GTTCTGAGGTTCCAGTCAAAGCAGATGTGGCTGGAAAAGTCTTGAAGATCCTCTATGATG
 
. : . : . : . : . : . :
rJMFF035D18+ ATGGAGAAGCTGTTGGCTATGGAGATCCGCTTGTTGCTGTGCTGCCATAGTTTCATGGTA
rJMSF007D22+ ATGGAGAAGCTGTTGGCTATGGAGATCCGCTTGTTGCTGTGCTGCCATAGTTTCATGGTA
rJMFF006I20+ ATGGAGAAGCTGTTGGCTATGGAGATCCGCTTGTTGCTGTGCTGCCATAGTTTCATGGTA
rJMFF033O12+ ATGGAGAAGCTGTTGGCTATGGAGATCCGCTTGTTGCTGTGCTGCCATAGTTTCATGGTA
                      ____________________________________________________________
consensus ATGGAGAAGCTGTTGGCTATGGAGATCCGCTTGTTGCTGTGCTGCCATAGTTTCATGGTA
 
. : . : . : . : . : . :
rJMFF035D18+ TGAACCGAAGATTTTTGTGGCAATACTATGTTGTGTTGGTTCACATTTTAAGAGATCAAG
rJMSF007D22+ TGAACCGAAGATTTTTGTGGCAATACTATGTTGTGTTGGTTCACATTTTAAGAGATCAAG
rJMFF006I20+ TGAACCGAAGATTTTTGTGGCAATACTATGTTGTGTTGGTTCACATTTTAAGAGATCAAG
rJMFF033O12+ TGAACCGAAGATTTTTGTGGCAATACTATGTTGTGTTGGTTCACATTTTAAGAGATCAAG
                      ____________________________________________________________
consensus TGAACCGAAGATTTTTGTGGCAATACTATGTTGTGTTGGTTCACATTTTAAGAGATCAAG
 
. : . : . : . : . : . :
rJMFF035D18+ CAGACGAGTTCTTAGTTTTCTAGTAATTCTCCGCTATTCCAAGTTTGCATCATAATCTTG
rJMSF007D22+ CAGACGAGTTCTTAGTTTTCTAGTAATTCTCCGCTATTCCAAGTTTGCATCATAATCTTG
rJMFF006I20+ CAGACGAGTTCTTAGTTTTCTAGTAATTCTCCGCTATTCCAAGTTTGCATCATAATCTTG
rJMFF033O12+ CAGACGAGTTCTTAGTTTTCTAGTAATTCTCCGCTATTCCAAGTTTGCATCATAATCTTG
                      ____________________________________________________________
consensus CAGACGAGTTCTTAGTTTTCTAGTAATTCTCCGCTATTCCAAGTTTGCATCATAATCTTG
 
. : . : . : . : . : . :
rJMFF035D18+ ATTTGGTAGAATAGGGTATAGATGGGTGGTGTTTACTGTTGTTACTTTTTGAGAGCTAAG
rJMSF007D22+ ATTTGGTAGAATAGGGTATAGATGGGTGGTGTTTACTGTTGTTACTTTTTGAGAGCTAAG
rJMFF006I20+ ATTTGGTAGAATAGGGTATAGATGGGTGGTGTTTACTGTTGTTACTTTTTGAGAGCTAAG
rJMFF033O12+ ATTTGGTAGAATAGGGTATAGATGGGTGGTGTTTACTGTTGTTACTTTTTGAGAGCTAAG
                      ____________________________________________________________
consensus ATTTGGTAGAATAGGGTATAGATGGGTGGTGTTTACTGTTGTTACTTTTTGAGAGCTAAG
 
. : . : . : . : . : . :
rJMFF035D18+ TTTGCTATTGATCCAGAATAAGTGATTTTCCACTATTTGGCATGATGCTATGGATCCTCA
rJMSF007D22+ TTTGCTATTGATCCAGAATAAGTGATTTTCCACTATTTGGCATGATGCTATGGATCCTCA
rJMFF006I20+ TTTGCTATTGATCCAGAATAAGTGATTTTCCACTATTTGGCATGATGCTATGGATCCTCA
rJMFF033O12+ TTTGCTATTGATCCAGAATAAGTGATTTTCCACTATTTGGCATGATGCTATGGATCCTCA
                      ____________________________________________________________
consensus TTTGCTATTGATCCAGAATAAGTGATTTTCCACTATTTGGCATGATGCTATGGATCCTCA
 
. : . : . : . : . : . :
rJMFF035D18+ ATGAACCTTTTCTACAGATGTGGCGAACATTAACGTGAATATTA
rJMSF007D22+ ATGAACCTTTTCTACAGATGTGGCGAAC
rJMFF006I20+ ATGAACCTTTTCTACAGATGTGGCGAACATTAACGTGAATATTAATGAACATTTTTTTGT
rJMFF033O12+ ATGAACCTTTTCTACAGATGTGGCGAACATTAACGTGAATATTAATGAACATTTTTTTGT
                      ____________________________________________________________
consensus ATGAACCTTTTCTACAGATGTGGCGAACATTAACGTGAATATTAATGAACATTTTTTTGT
 
. : . : . : . : . : . :
rJMFF006I20+ TTAGAACAGTGAAAAACATCCATTACTGTATGGGTATTCATTATAAATATTACGAACAC
rJMFF033O12+ TTAGAACAGTGAAAAACATCCATTACTGTATGGGTATTCATTATAAATATTACGAACACT
                      ____________________________________________________________
consensus TTAGAACAGTGAAAAACATCCATTACTGTATGGGTATTCATTATAAATATTACGAACACT