Previous Contig 009785:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021C24Sequence453014486gb:AY086891_15719313e-25Arabidopsis thaliana clone 29150 mRNA, complete sequence.640009785 (4)gb:AY086891_15719311e-62Arabidopsis thaliana clone 29150 mRNA, complete sequence.
JMFF033N11Sequence457009785 (4)gb:AY086891_15719311e-25Arabidopsis thaliana clone 29150 mRNA, complete sequence.733009785 (4)gb:AY086891_15719314e-63Arabidopsis thaliana clone 29150 mRNA, complete sequence.
JMSF038N03Sequence656019991gb:AY086891_15719313e-53Arabidopsis thaliana clone 29150 mRNA, complete sequence.856009785 (4)gb:AY086891_15719316e-63Arabidopsis thaliana clone 29150 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038N03+ CATGGCGATGTTGTC
                      ____________________________________________________________
consensus CATGGCGATGTTGTC
 
. : . : . : . : . : . :
rJMSF038N03+ ATCTGCCTCTCCAACTCACTTCCCATCTTTCTCTCCTTCCAAATCCAACCTTTCTTCCAA
                      ____________________________________________________________
consensus ATCTGCCTCTCCAACTCACTTCCCATCTTTCTCTCCTTCCAAATCCAACCTTTCTTCCAA
 
. : . : . : . : . : . :
rJMSF038N03+ GCTCTTTCACTCCCTCACTCCGCGAAAGCTTCACTTCTTGGTCCACACCAGCGCTGCCGG
                      ____________________________________________________________
consensus GCTCTTTCACTCCCTCACTCCGCGAAAGCTTCACTTCTTGGTCCACACCAGCGCTGCCGG
 
. : . : . : . : . : . :
rJMSF038N03+ GCAAGAAAAGGGGAGTGGACCTCCTGTTGCGGTTGAGGACTCTACTCTGAGCTCCAATGG
rJMFF033N11+ TGAGCTCCAATGG
                      ____________________________________________________________
consensus GCAAGAAAAGGGGAGTGGACCTCCTGTTGCGGTTGAGGACTCTACTCTGAGCTCCAATGG
 
. : . : . : . : . : . :
rJMSF038N03+ GTCGCCTGCATCGGTGGCTGCCGGAGCTCCGGCGCCGGAGGTTGTCAGCAAGTTCCGAGA
rJMFF021C24+ GAGCTCCGGCGCCGGAGGTTGTCAGCAAGTTCCGAGA
JMFF033N11- GTGGCTGCCGGAGCTCCGGCGCCGGAGGTTGTCAGCAAGTTCCGAGA
rJMFF033N11+ GTCGCCTGCATCGGTGGCTGCCGGAGCTCCGGCGCCGGAGGTTGTCAGCAAGTTCCGAGA
                      ____________________________________________________________
consensus GTCGCCTGCATCGGTGGCTGCCGGAGCTCCGGCGCCGGAGGTTGTCAGCAAGTTCCGAGA
 
. : . : . : . : . : . :
rJMSF038N03+ TCCTCGATGGGTTGGAGGGAGTTGGGAGTTGCGTCAGTTTCAGACCGATGGGAAGACCAA
rJMFF021C24+ TCCTCGATGGGTTGGAGGGAGTTGGGAGTTGCGTCAGTTTCAGACCGATGGGGAGACCAA
JMFF033N11- TCCTCGATGGGTTGGAGGGAGTTGGGAGTTGCGTCAGTTTCAGACCGATGGGAAGACCAA
rJMFF033N11+ TCCTCGATGGGTTGGAGGGAGTTGGGAGTTGCGTCAGTTTCAGACCGATGGGAAGACCAA
                      ____________________________________________________________
consensus TCCTCGATGGGTTGGAGGGAGTTGGGAGTTGCGTCAGTTTCAGACCGATGGGAAGACCAA
 
. : . : . : . : . : . :
rJMSF038N03+ TTGGGATGGTGTGATTGATGCCGAGGTTAAGAGGAGGAAATGGTTAGAAGATAACCCGGA
rJMFF021C24+ TTGGGATGGTGTGATTGATGCCGAGGTTAAGAGGAGGAAATGGTTAGAAGATAACCCGGA
JMFF033N11- TTGGGATGGTGTGATTGATGCCGAGGTTAAGAGGAGGAAATGGTTAGAAGATAACCCGGA
rJMFF033N11+ TTGGGATGGTGTGATTGATGCCGAGGTTAAGAGGAGGAAATGGTTAGAAGATAACCCGGA
                      ____________________________________________________________
consensus TTGGGATGGTGTGATTGATGCCGAGGTTAAGAGGAGGAAATGGTTAGAAGATAACCCGGA
 
. : . : . : . : . : . :
rJMSF038N03+ GACATCGAGCAACCAAGATCCTGTGGTTTTTGACACTTCCATTATTCCTTGGTGGGCATG
rJMFF021C24+ GACATCGAGCAGCCAAGATCCTGTGGTTTTTGACACTTCCATTATTCCTTGGTGGGCATG
JMFF033N11- GACATCGAGCAACCAAGATCCTGTGGTTTTTGACACTTCCATTATTCCTTGGTGGGCATG
rJMFF033N11+ GACATCGAGCAACCAAGATCCTGTGGTTTTTGACACTTCCATTATTCCTTGGTGGGCATG
                      ____________________________________________________________
consensus GACATCGAGCAACCAAGATCCTGTGGTTTTTGACACTTCCATTATTCCTTGGTGGGCATG
 
. : . : . : . : . : . :
rJMSF038N03+ GATGAAGAGGTTCCACCTTCCTGAAGCTGAAATCCTTAATGGGCGAGCTGCAATGGTAGG
rJMFF021C24+ GATGAAGAGGTTCCACCTTCCTGAAGCTGAAATCCTTAATGGGCGAGCTGCAATGGTAGG
JMFF033N11- G
rJMFF033N11+ GATGAAGAGGTTCCACCTTCCTGAAGCTGAAATCCTTAATGGGCGAGCTGCAATGGTAGG
                      ____________________________________________________________
consensus GATGAAGAGGTTCCACCTTCCTGAAGCTGAAATCCTTAATGGGCGAGCTGCAATGGTAGG
 
. : . : . : . : . : . :
rJMSF038N03+ ATTCTTTATGGCTTACCTGGTTGACAGCTTGACCGGATTAGGCCTAGTGGATCAAATGGG
rJMFF021C24+ ATTCTTTATGGCTTACCTGGTTGACAGCTTGACCGGATTAGGCCTAGTGGATCAAATGGG
rJMFF033N11+ ATTCTTTATGGCTTACCTGGTTGACAGCTTGACCGGATTAGGCCTAGTGGATCAAATGGG
                      ____________________________________________________________
consensus ATTCTTTATGGCTTACCTGGTTGACAGCTTGACCGGATTAGGCCTAGTGGATCAAATGGG
 
. : . : . : . : . : . :
rJMSF038N03+ CAATTTCTTCTGCAAAACCTTGTTGTTTGTAACAGTAGGTGGAGTTCTTTTGGTCCGAAA
rJMFF021C24+ CAATTTCTTCTGCAAAACCTTGTTGTTTGTAACAGTAGGTGGAGTTCTTTTGGTCCGAAA
rJMFF033N11+ CAATTTCTTCTGCAAAACCTTGTTGTTTGTAACAGTAGGTGGAGTTCTTTTGGTCCGAAA
                      ____________________________________________________________
consensus CAATTTCTTCTGCAAAACCTTGTTGTTTGTAACAGTAGGTGGAGTTCTTTTGGTCCGAAA
 
. : . : . : . : . : . :
rJMSF038N03+ GAATGAGGACATAGAAGCACTGAAGAAGTTTCTAGAGGAGACAACATTCTACGACAAGCA
rJMFF021C24+ GAATGAGGACATAGAAGCACTGAAGAAGTTTCTAGAGGAGACAACATTCTACGACAAGCA
rJMFF033N11+ GAATGAGGACATAGAAGCACTGAAGAAGTTTCTAGAGGAGACAACATTCTACGACAAGCA
                      ____________________________________________________________
consensus GAATGAGGACATAGAAGCACTGAAGAAGTTTCTAGAGGAGACAACATTCTACGACAAGCA
 
. : . : . : . : . : . :
rJMSF038N03+ GTGGCAGGCAAGTTGG
rJMFF021C24+ GTGGCAGGCAAGTTGG
rJMFF033N11+ GTGGCAGGCAAGTTGGAAAAAAGAGATTTCCACCGACTCTAATTGATTATTAATTAAGCT
                      ____________________________________________________________
consensus GTGGCAGGCAAGTTGGAAAAAAGAGATTTCCACCGACTCTAATTGATTATTAATTAAGCT
 
. : . : . : . : . : . :
rJMFF033N11+ TTAATCTGTTGTATAAGCTAAGGTTTCAGAAATTTTATATGTTTAATTAGTCAGTGCGAC
                      ____________________________________________________________
consensus TTAATCTGTTGTATAAGCTAAGGTTTCAGAAATTTTATATGTTTAATTAGTCAGTGCGAC
 
. : . : . : . : . : . :
rJMFF033N11+ TGAAACTAAGTATTTGTGTTCTTAAGATCGATGCATTACAGTACATCCTATGTTCATCAT
                      ____________________________________________________________
consensus TGAAACTAAGTATTTGTGTTCTTAAGATCGATGCATTACAGTACATCCTATGTTCATCAT
 
. : . : . : . : . : . :
rJMFF033N11+ CATCTTCCTAGTTGATTGATTTTATGATGGCTGTTGTGTTGGAAAACATTATCAAAATCA
                      ____________________________________________________________
consensus CATCTTCCTAGTTGATTGATTTTATGATGGCTGTTGTGTTGGAAAACATTATCAAAATCA