Previous Contig 009776:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033J13Sequence562009776 (2)gb:AY049269_15619112e-40Arabidopsis thaliana AT5g52420/K24M7_17 mRNA, complete cds.>gb:AY090285_1574037 767009776 (2)gb:AB019226_15140706e-60Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K24M7.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF033J13- AAAAGCTTAGCTTCCAATTTTCTCGAAGAAAACGAAAAAAGGGATAGCAAACTAAC
                      ____________________________________________________________
consensus AAAAGCTTAGCTTCCAATTTTCTCGAAGAAAACGAAAAAAGGGATAGCAAACTAAC
 
. : . : . : . : . : . :
JMFF033J13- ATGTCGGGTGGAATCGGGCCATGCAGTGACATACATCTCCAGAAGGAGAAGGAGGAGCAG
rJMFF033J13+ TCGGGCCATGCAGTGACATACATNTCCAGAAGGAGAAGGAGGAGCAG
                      ____________________________________________________________
consensus ATGTCGGGTGGAATCGGGCCATGCAGTGACATACATCTCCAGAAGGAGAAGGAGGAGCAG
 
. : . : . : . : . : . :
JMFF033J13- ACGGCGGCGGTGACGGAAGTAGCAGGGAAGCCGGCGCGGCGGGGATTTTTGAGCTTACGG
rJMFF033J13+ ACGGCGGCGGTGACGGAAGTAGCAGGGAAGCCGGCGCGGCGGGGATTTTTGAGCTTACGG
                      ____________________________________________________________
consensus ACGGCGGCGGTGACGGAAGTAGCAGGGAAGCCGGCGCGGCGGGGATTTTTGAGCTTACGG
 
. : . : . : . : . : . :
JMFF033J13- CAGCTGAACGTGTTGGCGGTGATGATGGTGCTGTCGGCCAGCGGCATGGTGAGCATGGAA
rJMFF033J13+ CAGCTGAACGTGTTGGCGGTGATGATGGTGCTGTCGGCCAGCGGCATGGTGAGCATGGAA
                      ____________________________________________________________
consensus CAGCTGAACGTGTTGGCGGTGATGATGGTGCTGTCGGCCAGCGGCATGGTGAGCATGGAA
 
. : . : . : . : . : . :
JMFF033J13- GATTTGGGGTTTGTGGTGTTCTCAGTCATCTACTTGTATTTCATCTCCAAGGCGGCGTTT
rJMFF033J13+ GATTTGGGGTTTGTGGTGTTCTCAATCATCTACTTGTATTTCATCTCCAAGGCGGCGTTT
                      ____________________________________________________________
consensus GATTTGGGGTTTGTGGTGTTCTCAGTCATCTACTTGTATTTCATCTCCAAGGCGGCGTTT
 
. : . : . : . : . : . :
JMFF033J13- CCGCAGACCACTCCGCCGTGGACTGGTTCCGTGTTTGGCCAAAATAACCGGACCCTCCGC
rJMFF033J13+ CCGCAGACCACTCCGCCGTGGACTGGTTCCGTGTTTGGCCAAAATAACCGGACCCTCCGC
                      ____________________________________________________________
consensus CCGCAGACCACTCCGCCGTGGACTGGTTCCGTGTTTGGCCAAAATAACCGGACCCTCCGC
 
. : . : . : . : . : . :
JMFF033J13- CTCTATATGTTGACTTCGGCGGTCATCGGCTTGCTTCTCCCCGTAGCCTATATTTTTGAA
rJMFF033J13+ CTCTATATGTTGACTTCGGCGGTCATCGGCTTGCTTCTCCCCGTAGCCTATATTTTTGAA
                      ____________________________________________________________
consensus CTCTATATGTTGACTTCGGCGGTCATCGGCTTGCTTCTCCCCGTAGCCTATATTTTTGAA
 
. : . : . : . : . : . :
JMFF033J13- GGTATTGTTGAAGGGGACAAGGAGGGCATTAAGGCAGCAGTTCCGCACTTGTTTCTATTG
rJMFF033J13+ GGTATTGTTGAAGGGGACAAGGAGGGCATTAAGGCAGCAGTTCCGCACTTGTTTCTATTG
                      ____________________________________________________________
consensus GGTATTGTTGAAGGGGACAAGGAGGGCATTAAGGCAGCAGTTCCGCACTTGTTTCTATTG
 
. : . : . : . : . : . :
JMFF033J13- GGCAGCCAGGTGTTCATGGAAGGGGTGGCGTCCACAGAGCGGTTCTCATTGCCGGTCCGG
rJMFF033J13+ GGCAGCCAGGTGTTCATGGAAGGGGTGGCGTCCACAGAGCGGTTCTCATTGCCGGTCCGG
                      ____________________________________________________________
consensus GGCAGCCAGGTGTTCATGGAAGGGGTGGCGTCCACAGAGCGGTTCTCATTGCCGGTCCGG
 
. : . : . : . : . : . :
JMFF033J13- GTTTTCGTGCCGGTTTTCTACAACGC
rJMFF033J13+ GTTTTCGTGCCGGTTTTCTACAACGCCAAGAGGATTTTCACCCTGGCTGAGTGGCTGAGA
                      ____________________________________________________________
consensus GTTTTCGTGCCGGTTTTCTACAACGCCAAGAGGATTTTCACCCTGGCTGAGTGGCTGAGA
 
. : . : . : . : . : . :
rJMFF033J13+ AGTGAGATATCCAAGGAGAGTAGTGGGCGGAGGTTGTACGTTGGGAGAGGTCTGGCGGTT
                      ____________________________________________________________
consensus AGTGAGATATCCAAGGAGAGTAGTGGGCGGAGGTTGTACGTTGGGAGAGGTCTGGCGGTT
 
. : . : . : . : . : . :
rJMFF033J13+ GCCAATATGGCGTTTTGGTGCTTTAACTTGTTTGGGTTCTTGGTGCCGGTTTACCTCCCT
                      ____________________________________________________________
consensus GCCAATATGGCGTTTTGGTGCTTTAACTTGTTTGGGTTCTTGGTGCCGGTTTACCTCCCT
 
. : . : . : . : . : . :
rJMFF033J13+ AAGGCCTTCAAGATTTACTATTCCAACCACAAGCATAATAATTAAGGACTAATTATATTA
                      ____________________________________________________________
consensus AAGGCCTTCAAGATTTACTATTCCAACCACAAGCATAATAATTAAGGACTAATTATATTA
 
. : . : . : . : . : . :
rJMFF033J13+ TTATTACTAGTTGTCACTCATTTGTTTTATCCTAACCAATGTTATTTTGTTCTGTTTTTT
                      ____________________________________________________________
consensus TTATTACTAGTTGTCACTCATTTGTTTTATCCTAACCAATGTTATTTTGTTCTGTTTTTT