Previous Contig 009772:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033I17Sequence557009772 (4)gb:AC005309_15324552e-61Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>761009772 (4)gb:AC005309_15324553e-52Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>
JMSF042P22Sequence726009772 (4)gb:AC005309_15324552e-88Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>706009772 (4)pir|E84919|E849193e-40hypothetical protein At2g47790 [imported] - Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF033I17- GTT
JMSF042P22- GGTT
                      ____________________________________________________________
consensus GGTT
 
. : . : . : . : . : . :
JMFF033I17- ATTGCTTCTGCTTCTTTCATCTTCAACATTATCATCGATCAACTAAGAGAGATGGAAGGA
JMSF042P22- ATTGCTTCTGCTTCTTTCATCTTCAACATTATCATCGATCAACTAAGAGAGATGGAAGGA
                      ____________________________________________________________
consensus ATTGCTTCTGCTTCTTTCATCTTCAACATTATCATCGATCAACTAAGAGAGATGGAAGGA
 
. : . : . : . : . : . :
JMFF033I17- GCAGTGGAGATGGATGTGGAAGAAGAATCAACCCCCAGCTCAAACTCATTCAAGCGCGTC
JMSF042P22- GCAGTGGAGATGGATGTGGAAGAAGAATCAACCCCCAGCTCAAACTCATTCAAGCGCGTC
                      ____________________________________________________________
consensus GCAGTGGAGATGGATGTGGAAGAAGAATCAACCCCCAGCTCAAACTCATTCAAGCGCGTC
 
. : . : . : . : . : . :
JMFF033I17- GGACTCAAAAACTATATCCAAACTAATTTCGGAGATGATTACGTCTTCGAAATCGTTCCC
JMSF042P22- GGACTCAAAAACTATATCCAAACTAATTTCGGAGATGATTACGTCTTCGAAATCGTTCCC
                      ____________________________________________________________
consensus GGACTCAAAAACTATATCCAAACTAATTTCGGAGATGATTACGTCTTCGAAATCGTTCCC
 
. : . : . : . : . : . :
JMFF033I17- AAGGAAGATTGGAGCTCAATGGCGGTGTCACTCTCGACGAACGCCGTGAAATTTTACTCT
JMSF042P22- AAGGAAGATTGGAGCTCAATGGCGGTGTCACTCTCGACGAACGCCGTGAAATTTTACTCT
                      ____________________________________________________________
consensus AAGGAAGATTGGAGCTCAATGGCGGTGTCACTCTCGACGAACGCCGTGAAATTTTACTCT
 
. : . : . : . : . : . :
JMFF033I17- CCGGTGAGTGGACAGTATTTGGGGGAATGTAAAGGTCACACTTCAACGATCAATCACATT
JMSF042P22- CCGGTGAGTGGACAGTATTTGGGGGAATGTAAAGGTCACACTTCAACGATCAATCACATT
                      ____________________________________________________________
consensus CCGGTGAGTGGACAGTATTTGGGGGAATGTAAAGGTCACACTTCAACGATCAATCACATT
 
. : . : . : . : . : . :
JMFF033I17- TCCTTTGCGGCGAGTCCTTCACTTCCGCATGTGCTGCACTCTTGTTCTTCCGATGGCACC
JMSF042P22- TCCTTTGCGGCGAGTCCTTCACTTCCGCATGTGCTGCACTCTTGTTCTTCCGATGGCACC
                      ____________________________________________________________
consensus TCCTTTGCGGCGAGTCCTTCACTTCCGCATGTGCTGCACTCTTGTTCTTCCGATGGCACC
 
. : . : . : . : . : . :
JMFF033I17- ATCAGAGCTTGGGACACTAGGTCATTCCACCAGGTATCTTGCATAAATGCGGGGGCTTCT
JMSF042P22- ATCAGAGCTTGGGACACTAGGTCATTCCACCAGGTATCTTGCATAAATGCGGGGGCTTCT
                      ____________________________________________________________
consensus ATCAGAGCTTGGGACACTAGGTCATTCCACCAGGTATCTTGCATAAATGCGGGGGCTTCT
 
. : . : . : . : . : . :
JMFF033I17- CAAGAGGTATTCAGCTTCTCATTTGGGGGAGCAGCTGATAATCTTGTTGCAGCAGGGTGT
JMSF042P22- CAAGAGGTATTCAGCTTCTCATTTGGGGGAGCAGCTGATAATCTTGTTGCAGCAGGGTGT
                      ____________________________________________________________
consensus CAAGAGGTATTCAGCTTCTCATTTGGGGGAGCAGCTGATAATCTTGTTGCAGCAGGGTGT
 
. : . : . : . : . : . :
JMFF033I17- AACTCTCAGATACTCTTCTGGGACTGGAGGACCCAAAAGCAGGTTGCATGCTTGGATGAA
JMSF042P22- AACTCTCAGATACTCTTCTGGGACTGGAGGACCCAAAAGCAGGTTGCATGCTTGGATGAA
                      ____________________________________________________________
consensus AACTCTCAGATACTCTTCTGGGACTGGAGGACCCAAAAGCAGGTTGCATGCTTGGATGAA
 
. : . : . : . : . : . :
JMFF033I17- TCTCATATGGAGGA
JMSF042P22- TCTCATATGGAGGATGTTACTCAAGTTAAATTTATTCCAGGCCACCAAAACAAGCTTCTT
                      ____________________________________________________________
consensus TCTCATATGGAGGATGTTACTCAAGTTAAATTTATTCCAGGCCACCAAAACAAGCTTCTT
 
. : . : . : . : . : . :
JMSF042P22- TCTGCTTCTGTTGATGGATTGATGTGTTTATTTGATACTGCTGGGGATATCAATGATGAT
                      ____________________________________________________________
consensus TCTGCTTCTGTTGATGGATTGATGTGTTTATTTGATACTGCTGGGGATATCAATGATGAT
 
. : . : . : . : . : . :
JMSF042P22- GATCATTTGGCCTCAGTGCTCAATGTTGGGACGTCAATTGGAAAAGTTGGATTTTTTGGA
rJMSF042P22+ TTTTGGA
rJMFF033I17+ GCTCAATGTTGGGACGTCAATTGGAAAAGTTGGATTTTTTGGA
                      ____________________________________________________________
consensus GATCATTTGGCCTCAGTGCTCAATGTTGGGACGTCAATTGGAAAAGTTGGATTTTTTGGA
 
. : . : . : . : . : . :
JMSF042P22- GA
rJMSF042P22+ GAGACAAAATAAAAAACTTTGGTGTTTAACTCATATAGAAACGTTAAGTGTCTGGGACTG
rJMFF033I17+ GAGAC-AAATAAAAAACTTTGGTGTTTAACTCATATAGAAACGTTAAGTGTCTGGGACTG
                      ____________________________________________________________
consensus GAGACAAAATAAAAAACTTTGGTGTTTAACTCATATAGAAACGTTAAGTGTCTGGGACTG
 
. : . : . : . : . : . :
rJMSF042P22+ GCAAGATGAAAGGGCCGAAGCAACATTTGACGATGCCCGGTCTTTGGCATCCAAAAAACT
rJMFF033I17+ GCAAGATGAAAGGGCCGAAGCAACATTTGACGATGCCCGGTCTTTGGCATCC-AAAAACT
                      ____________________________________________________________
consensus GCAAGATGAAAGGGCCGAAGCAACATTTGACGATGCCCGGTCTTTGGCATCCAAAAAACT
 
. : . : . : . : . : . :
rJMSF042P22+ GGATTTTAGATCAGGTGGACTATTTTATTGATTGCCACTACTCAGTCGAGGAAGACCGCC
rJMFF033I17+ GGATTTTAGATCAGGTGGACTATTTTATTGATTGCCACTACTCAGTCGAGGAAGACCGCC
                      ____________________________________________________________
consensus GGATTTTAGATCAGGTGGACTATTTTATTGATTGCCACTACTCAGTCGAGGAAGACCGCC
 
. : . : . : . : . : . :
rJMSF042P22+ TGTGGGCAGTAGGCGGGACAAATGGTGGCACAATAGGATACTTTCCCATAGGTTACAAAG
rJMFF033I17+ TGTGGGCAGTAGGCGGGACAAATGGTGGCACAATAGGATACTTTCCCATAGGTTACAAAG
                      ____________________________________________________________
consensus TGTGGGCAGTAGGCGGGACAAATGGTGGCACAATAGGATACTTTCCCATAGGTTACAAAG
 
. : . : . : . : . : . :
rJMSF042P22+ GGACTCTAGCAATTGGGCCCCCAGATGTTGTTTTACAAGGTGGACATGAAGGTGTAGTTA
rJMFF033I17+ GGACTCTAGCAATTGGGCCCCCAGATGTTGTTTTACAAGGTGGACATGAAGGTGTAGTTA
                      ____________________________________________________________
consensus GGACTCTAGCAATTGGGCCCCCAGATGTTGTTTTACAAGGTGGACATGAAGGTGTAGTTA
 
. : . : . : . : . : . :
rJMSF042P22+ GGAGTGTGGTGCCAGTGTCCAGATTGCCCGCTGGAATCACTCAAAACAAAGGCATATTTG
rJMFF033I17+ GGAGTGTGGTGCCAGTGTCCAGATTGCCCGCTGGAATCACTCAAAACAAAGGCATATTTG
                      ____________________________________________________________
consensus GGAGTGTGGTGCCAGTGTCCAGATTGCCCGCTGGAATCACTCAAAACAAAGGCATATTTG
 
. : . : . : . : . : . :
rJMSF042P22+ GATGGACGGGAGGTGAAGATGGTCGCCTATGTTGTTGGCTGTCTGACAGATCAGCTGATA
rJMFF033I17+ GATGGACGGGAGGTGAAGATGGTCGCCTATGTTGTTGGCTGTCTGACAGATCAGCTGATA
                      ____________________________________________________________
consensus GATGGACGGGAGGTGAAGATGGTCGCCTATGTTGTTGGCTGTCTGACAGATCAGCTGATA
 
. : . : . : . : . : . :
rJMSF042P22+ TGAACCGATCATGGATCTCAAGCACTCTAGCTTTGAAATCGCCAAAACCACACTTGAAAA
rJMFF033I17+ TGAACCGATCATGGATCTCAAGCACTCTAGCTTTGAAATCGCCAAAACCACACTTGAAAA
                      ____________________________________________________________
consensus TGAACCGATCATGGATCTCAAGCACTCTAGCTTTGAAATCGCCAAAACCACACTTGAAAA
 
. : . : . : . : . : . :
rJMSF042P22+ AGAGGCATTCTCCATATTAGCAGCACTTATGTTGTTGTAAAGTAGTTTATACCCTGTGTG
rJMFF033I17+ AGAGGCATTCTCCATATTAGCAGCACTTATGTTGTTGTAAAGTAGTTTATACCCTGTGTG
                      ____________________________________________________________
consensus AGAGGCATTCTCCATATTAGCAGCACTTATGTTGTTGTAAAGTAGTTTATACCCTGTGTG
 
. : . : . : . : . : . :
rJMSF042P22+ TGCGTGTGTGTGTATGTATGTGTTTTTTTCAGTCATGTTTATTTAGAGTAGATTCATTTC
rJMFF033I17+ TGCGTGTGTGTGTATGTATGTGTTTTTTTCAGTCATGTTTATTTAGAGTAGATTCATTTC
                      ____________________________________________________________
consensus TGCGTGTGTGTGTATGTATGTGTTTTTTTCAGTCATGTTTATTTAGAGTAGATTCATTTC
 
. : . : . : . : . : . :
rJMSF042P22+ TCCTTGAGACAAGTATCTTTTTCCTAGTTTTAGTAGTTTGTAGTTTGAGTGGGCTTTGGT
rJMFF033I17+ TCCTTGAGACAAGTATCTTTTTCCTAGTTTTAGTAGTTTGTAGTTTGAGTGGGCTTTGGT
                      ____________________________________________________________
consensus TCCTTGAGACAAGTATCTTTTTCCTAGTTTTAGTAGTTTGTAGTTTGAGTGGGCTTTGGT
 
. : . : . : . : . : . :
rJMSF042P22+ TTTCGGGTTCTCACAAAATTTTCTCGACTTCCGAATGT
rJMFF033I17+ TTTCGGGTTCTCACAAAATTTTCTCGACTTCCGAATGTTGCACTTATACAGTAATGAATT
                      ____________________________________________________________
consensus TTTCGGGTTCTCACAAAATTTTCTCGACTTCCGAATGTTGCACTTATACAGTAATGAATT