Previous Contig 009761:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015O08Sequence521006809 (7)gb:AP004751_18443673e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P049192009761 (4)
JMFF033E15Sequence541006809 (7)gb:AP004751_18443673e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P049737009761 (4)gb:AP004751_18443671e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P049
JMFF036N14Sequence548006809 (7)gb:AP004751_18443677e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P049749009761 (4)pir|H84807|H848077e-42probable phospholipid cytidylyltransferase [imported] - Arabidopsis thaliana>gb:
JMSF032E08Sequence692006809 (7)gb:AP004751_18443672e-30Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P049738009761 (4)pir|H84807|H848075e-48probable phospholipid cytidylyltransferase [imported] - Arabidopsis thaliana>gb:

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032E08+ CTGGTCATGTTGAGATTCTTAGGAGTGCCAGGCAA
rJMFF036N14+ GGTCATGTTGAGATTCTTAGGAGTGCCAGGCAA
                      ____________________________________________________________
consensus CTGGTCATGTTGAGATTCTTAGGAGTGCCAGGCAA
 
. : . : . : . : . : . :
rJMSF032E08+ CTTGGAGATTTTCTTTTAGTTGGGATTTATGATGACAACACTGTCAGTGGAGTTCGAGGA
rJMFF036N14+ CTNGGAGATTTTCTTTTAGTTGGGATTTATGATGACAACACTGTCAGTGGAGTTCGAGGA
                      ____________________________________________________________
consensus CTTGGAGATTTTCTTTTAGTTGGGATTTATGATGACAACACTGTCAGTGGAGTTCGAGGA
 
. : . : . : . : . : . :
rJMSF032E08+ ACACAGTATCCACTTATGAATTTGCACGAACGAAGTCTTAGTGTTCTGGCTT-CCCGTTA
rJMFF036N14+ ACACAGTATCCACTTATGAATTTGCACGAACGAAGTCTTAGTGTTCTGGCTT-CCCGTTA
rJMFF033E15+ TTCTGGCTTCCCCGTTA
                      ____________________________________________________________
consensus ACACAGTATCCACTTATGAATTTGCACGAACGAAGTCTTAGTGTTCTGGCTT-CCCGTTA
 
. : . : . : . : . : . :
rJMSF032E08+ TGTTGATGAAGTTATTATAGGTGCCCCTTGGGAAATTACTAAGGATATGATAACAACATT
rJMFF036N14+ CGTTGATGAAGTTATTATAGGTGCCCCTTGGGAAATTACTAAGGATATGATAACAACA-T
rJMFF033E15+ TGTTGATGAAGTTATTATAGGTGCCCCTTGGGAAATTACTAAGGATATGATAACAACATT
                      ____________________________________________________________
consensus TGTTGATGAAGTTATTATAGGTGCCCCTTGGGAAATTACTAAGGATATGATAACAACATT
 
. : . : . : . : . : . :
rJMSF032E08+ TAACATATCGCTTGTTGTGCATGGCACTGTTTCCGAAAGCAACTCTATGTTAAAAGATAC
rJMFF036N14+ TAACATATCGCTTGTTGTGCATGGCACTGTTTCCGAAAGCAACTCTATGTTAAAAGATAC
rJMFF033E15+ TAACATATCGCTTGTTGTGCATGGCACTGTTTCCGAAAGCAACTCTATGTTAAAAGATAC
                      ____________________________________________________________
consensus TAACATATCGCTTGTTGTGCATGGCACTGTTTCCGAAAGCAACTCTATGTTAAAAGATAC
 
. : . : . : . : . : . :
rJMSF032E08+ CTGTGATCCTTATGCTGTTCCTAAAAGCATGGGAATCTTCCGAATAATTCAGAGCCCCAA
rJMFF036N14+ CTGTGATCCTTATGCTGTTCCTAAAAGCATGGGAATCTTCCGAATAATTCAGAGCCCCAA
rJMFF033E15+ CTGTGATCCTTATGCTGTTCCTAAAAGCATGGGAATCTTCCGAATAATTCAGAGCCCCAA
                      ____________________________________________________________
consensus CTGTGATCCTTATGCTGTTCCTAAAAGCATGGGAATCTTCCGAATAATTCAGAGCCCCAA
 
. : . : . : . : . : . :
rJMSF032E08+ AGATATTACCACCACTTCAGTTGGCCAAAGGATCATTGCCAATCATGAGATCTATGTGAA
rJMFF036N14+ AGATATTACCACCACTTCAGTTGGCCAAAGGATCATTGCCAATCATGAGATCTATGTGAA
rJMFF033E15+ AGATATTACCACCACTTCAGTTGGCCAAAGGATCATTGCCAATCATGAGATCTATGTGAA
                      ____________________________________________________________
consensus AGATATTACCACCACTTCAGTTGGCCAAAGGATCATTGCCAATCATGAGATCTATGTGAA
 
. : . : . : . : . : . :
rJMSF032E08+ ACGGAATGCCAAGAAAGAAGCAAGCGAGAAGAAATACTATGCAGAGAAGAAATACGTCTC
rJMFF036N14+ ACGGAATGCCAAGAAAGAAGCAAGCGAGAAGAAATACTATGCAGAGAAGAAATACGTCTC
rJMFF033E15+ ACGGAATGCCAAGAAAGAAGCAAGCGAGAAGAAATACTATGCAGAGAAGAAATACGTCTC
                      ____________________________________________________________
consensus ACGGAATGCCAAGAAAGAAGCAAGCGAGAAGAAATACTATGCAGAGAAGAAATACGTCTC
 
. : . : . : . : . : . :
rJMSF032E08+ AGGTGAGTAGAAGCATGCGATGCGATGGTTTCTTGCAACTAACTTGCATTCTAGGAGCAG
rJMFF036N14+ AGGTGAGTAGAAGCATGCGATGCGATGGTTTCTTGCAACTAACTTGCATTCTAGGAGCAG
rJMFF015O08+ TGGTTTCTTGCAACTAACTTGCATTCTAGGAGCAG
rJMFF033E15+ AGGTGAGTAGAAGCATGCGATGCGATGGTTTCTTGCAACTAACTTGCATTCTAGGAGCAG
                      ____________________________________________________________
consensus AGGTGAGTAGAAGCATGCGATGCGATGGTTTCTTGCAACTAACTTGCATTCTAGGAGCAG
 
. : . : . : . : . : . :
rJMSF032E08+ TTGCTCCAAATTGAGGTAGTACTTCGTCTACCATTGTGTGTTCAAAGAATATATGAAAGC
rJMFF036N14+ TTGCTCCAAATTGAGGTAGTACTTCGTCTACCATTGTGTGTTCAAAGAATATATGAAAGC
rJMFF015O08+ TTGCTCCAAATTGAGGTAGTACTTCGTCTACCATTGTGTGTTCAAAGAATATATGAAAGC
rJMFF033E15+ TTGCTCCAAATTGAGGTAGTACTTCGTCTACCATTGTGTGTTCAAAGAATATATGAAAGC
                      ____________________________________________________________
consensus TTGCTCCAAATTGAGGTAGTACTTCGTCTACCATTGTGTGTTCAAAGAATATATGAAAGC
 
. : . : . : . : . : . :
rJMSF032E08+ GGGGGCCTCATATTTAGGGAAGGGTACGGTATCACTGCATCACCCAAGTTTTTATATTAT
rJMFF036N14+ GGGGGCCTCATATTTAGGGAAGGGTACGGTATCACTGCATCACCCAAGTTTTTATATTAT
rJMFF015O08+ GGGGGCCTCATATTTAGGGAAGGGTACGGTATCACTGCATCACCCAAGTTTTTATATTAT
rJMFF033E15+ GGGGGCCTCATATTTAGGGAAGGGTACGGTATCACTGCATCACCCAAGTTTTTATATTAT
                      ____________________________________________________________
consensus GGGGGCCTCATATTTAGGGAAGGGTACGGTATCACTGCATCACCCAAGTTTTTATATTAT
 
. : . : . : . : . : . :
rJMSF032E08+ CTTCAGGTTTTTGTTTTAATCCCCCCTTTCAAATACCGGTACTGTAAGCTAGTTTCCTAA
rJMFF036N14+ CTTCAGGTTTTTGTTTTAATCCCCCCTTTCAAATACCGGTACTGTAAGCTAGTTTCCTAA
rJMFF015O08+ CTTCAGGTTTTTGTTTTAATCCCCCCTTTCAAATACC
rJMFF033E15+ CTTCAGGTTTTTGTTTTAATCCCCCCTTTCAAATACCGGTACTGTAAGCTAGTTTCCTAA
                      ____________________________________________________________
consensus CTTCAGGTTTTTGTTTTAATCCCCCCTTTCAAATACCGGTACTGTAAGCTAGTTTCCTAA
 
. : . : . : . : . : . :
rJMSF032E08+ CATCATATCTTCCTATTCTTTATGTAATAGTAAAGTAAAATGT
rJMFF036N14+ CATCATATCTTCCTATTCTTTATGTAATAGTAAAGTAAAATGTTGTAATCCATAGTTA
rJMFF033E15+ CATCATATCTTCCTATTCTTTATGTAATAGTAAAGTAAAATGTTGTAATCCATAGTTAAT
                      ____________________________________________________________
consensus CATCATATCTTCCTATTCTTTATGTAATAGTAAAGTAAAATGTTGTAATCCATAGTTAAT
 
. : . : . : . : . : . :
rJMFF033E15+ TGTGTTTCTCATTCAATTTTGTGCATCTTTTTCTAGTATTTAAAACATTTATTATGTCTA
                      ____________________________________________________________
consensus TGTGTTTCTCATTCAATTTTGTGCATCTTTTTCTAGTATTTAAAACATTTATTATGTCTA
 
. : . : . : . : . : . :
rJMFF033E15+ GGAACACTTGCACTTGAAACCTCCAACCTTTCATGATGATTTAGCGTGAGTGCAAACTCA
                      ____________________________________________________________
consensus GGAACACTTGCACTTGAAACCTCCAACCTTTCATGATGATTTAGCGTGAGTGCAAACTCA