Previous Contig 009750:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033A23Sequence554004349 (3)gb:AC005397_15326493e-36Arabidopsis thaliana chromosome 2 clone T3F17 map CIC02E07, complete sequence.>g725009750 (3)gb:AF292397_17837715e-85Arabidopsis thaliana POZ/BTB containing-protein AtPOB1 mRNA, complete cds.
JMSF001L21Sequence289004349 (3)gb:AC005397_15326499e-07Arabidopsis thaliana chromosome 2 clone T3F17 map CIC02E07, complete sequence.>g718009750 (3)gb:AF292397_17837713e-86Arabidopsis thaliana POZ/BTB containing-protein AtPOB1 mRNA, complete cds.
JMSF033H06Sequence354004349 (3)710009750 (3)gb:AF292397_17837711e-85Arabidopsis thaliana POZ/BTB containing-protein AtPOB1 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF033H06+ GCTGAA
rJMSF001L21+ TTCAAAGCTGAA
rJMFF033A23+ GCTGAA
                      ____________________________________________________________
consensus TTCAAAGCTGAA
 
. : . : . : . : . : . :
rJMSF033H06+ GCACCATATCGGCAACGTTCCTTAGCTGCTGACGAAGCCAACATCTCATTCCGTCGCTTT
rJMSF001L21+ GCACCATATCGGCAACGTTCCTTAGCTGCTGACGAAGCCAACATCTCATTCCGTCGCTTT
rJMFF033A23+ GCACCATATCGGCAACGTTCCTTAGCTGCTGACGAAGCCAACATCTCATTCCGTCGCTTT
                      ____________________________________________________________
consensus GCACCATATCGGCAACGTTCCTTAGCTGCTGACGAAGCCAACATCTCATTCCGTCGCTTT
 
. : . : . : . : . : . :
rJMSF033H06+ GTGGAGCGGGCATACAAGTACAGACCAGTAAAAGTTGTCGAGTTTGAGTTGCCTCGTCCA
rJMSF001L21+ GTGGAGCGGGCATACAAGTACAGACCAGTAAAAGTTGTCGAGTTTGAGTTGCCTCGTCCA
rJMFF033A23+ GTGGAGCGGGCATACAAGTACAGACCAGTAAAAGTTGTCGAGTTTGAGTTGCCTCGTCCA
                      ____________________________________________________________
consensus GTGGAGCGGGCATACAAGTACAGACCAGTAAAAGTTGTCGAGTTTGAGTTGCCTCGTCCA
 
. : . : . : . : . : . :
rJMSF033H06+ CAGTGTATCGTTTACCTAGATTTAAAACGGGAAGAATGCTTGAATCTGTTTCCTGCTGGT
rJMSF001L21+ CAGTGTATCGTTTACCTAGATTTAAAACGGGAAGAATGCTTGAATCTGTTTCCTGCTGGT
rJMFF033A23+ CAGTGTATCGTTTACCTAGATTTAAAACGGGAAGAATGCTTGAATCTGTTTCCTGCTGGT
                      ____________________________________________________________
consensus CAGTGTATCGTTTACCTAGATTTAAAACGGGAAGAATGCTTGAATCTGTTTCCTGCTGGT
 
. : . : . : . : . : . :
rJMSF033H06+ AGAGTATATTCACAGGCCTTCCATTTAGGCGGGCAGGGATTCTTTCTGTCAGCCCATTGC
rJMSF001L21+ AGAGTATATTCACAGGCCTTCCATTTAGGCGGGCAGGGATTCTTTCTGTCAGCCCATTGC
rJMFF033A23+ AGAGTATATTCACAGGCCTTCCATTTAGGCGGGCAGGGATTCTTTCTGTCAGCCCATTGC
                      ____________________________________________________________
consensus AGAGTATATTCACAGGCCTTCCATTTAGGCGGGCAGGGATTCTTTCTGTCAGCCCATTGC
 
. : . : . : . : . : . :
rJMSF033H06+ AACATGGATCAACAGAGTTCATTCCACTGCTTTGGTCTTTTCTTGGGCATGCAAGAGAAA
rJMSF001L21+ AACATGGATCAACAGAGTTCATTCCACTGCTTTGGTCTTTTCTTGGGCATGCAAGAGAAA
rJMFF033A23+ AACATGGATCAACAGAGTTCATTCCACTGCTTTGGTCTTTTCTTGGGCATGCAAGAGAAA
                      ____________________________________________________________
consensus AACATGGATCAACAGAGTTCATTCCACTGCTTTGGTCTTTTCTTGGGCATGCAAGAGAAA
 
. : . : . : . : . : . :
rJMSF033H06+ GGATCGGTATCATTTGCAGTCGACTATGAGTTTGCGGCTAGGACTAAGCCAACCGAGGAA
rJMSF001L21+ GGATCGGTATCATTTGCAGTCGACTATGAGTTTGCGGCTAGGACTAAGCCAACCGAGGAA
rJMFF033A23+ GGATCGGTATCATTTGCAGTCGACTATGAGTTTGCGGCTAGGACTAAGCCAACCGAGGAA
                      ____________________________________________________________
consensus GGATCGGTATCATTTGCAGTCGACTATGAGTTTGCGGCTAGGACTAAGCCAACCGAGGAA
 
. : . : . : . : . : . :
rJMSF033H06+ TACGTGAGCAAGTATAAGGGGAACTACACGTTCACTGGTGGGAAGGCCGTTGGCTATAGG
rJMSF001L21+ TACGTGAGCAAGTATAAGGGGAACTACACGTTCACTGGTGGGAAGGCCGTTGGCTATAGG
rJMFF033A23+ TACGTGAGCAAGTATAAGGGGAACTACACGTTCACTGGTGGGAAGGCCGTTGGCTATAGG
                      ____________________________________________________________
consensus TACGTGAGCAAGTATAAGGGGAACTACACGTTCACTGGTGGGAAGGCCGTTGGCTATAGG
 
. : . : . : . : . : . :
rJMSF033H06+ AACCTGTTTGGTATACCTTGGACTGCATTTGTTGGTGACGATAGCCATTACTTCATGAAC
rJMSF001L21+ AACCTGTTTGGTATACCTTGGACTGCATTTGTTGGTGACGATAGCCATTACTTCATGAAC
rJMFF033A23+ AACCTGTTTGGTATACCTTGGACTGCATTTGTTGGTGACGATAGCCATTACTTCATGAAC
                      ____________________________________________________________
consensus AACCTGTTTGGTATACCTTGGACTGCATTTGTTGGTGACGATAGCCATTACTTCATGAAC
 
. : . : . : . : . : . :
rJMSF033H06+ GGAATTCTTCATCTTCGGGCCGAGCTGACCATCCGATAATGCCTTGTCTGACAGCAAGCG
rJMSF001L21+ GGAATTCTTCATCTTCGGGCCGAGCTGACCATCCGATAATGCCTTGTCTGACAGCAAGCG
rJMFF033A23+ GGAATTCTTCATCTTCGGGCCGAGCTGACCATCCGATAATGCCTTGTCTGACAGCAAGCG
                      ____________________________________________________________
consensus GGAATTCTTCATCTTCGGGCCGAGCTGACCATCCGATAATGCCTTGTCTGACAGCAAGCG
 
. : . : . : . : . : . :
rJMSF033H06+ CTATTTCTTTCAGTTCAGACAGGGCTTTGCACAACGGGTAAATGTTTATTGTAAACCCCA
rJMSF001L21+ CTATTTCTTTCAGTTCAGACAGGGCTTTGCACAACGGGTAAATGTTTATTGTAAACCCCA
rJMFF033A23+ CTATTTCTTTCAGTTCAGACAGGGCTTTGCACAACGGGTAAATGTTTATTGTAAACCCCA
                      ____________________________________________________________
consensus CTATTTCTTTCAGTTCAGACAGGGCTTTGCACAACGGGTAAATGTTTATTGTAAACCCCA
 
. : . : . : . : . : . :
rJMSF033H06+ GTTAGCATTGTAACTGGTTAGAGTGAAGCATGCTGTAGTTTCGGGTGTCCTTTAAACATA
rJMSF001L21+ GTTAGCATTGTAACTGGTTAGAGTGAAGCATGCTGTAGTTTCGGGTGTCCTTTAAATATA
rJMFF033A23+ GTTAGCATTGTAACTGGTTAGAGTGAAGCATGCTGTAGTTTCGGGTGTCCTTTAAATATA
                      ____________________________________________________________
consensus GTTAGCATTGTAACTGGTTAGAGTGAAGCATGCTGTAGTTTCGGGTGTCCTTTAAATATA
 
. : . : . : . : . : . :
rJMSF033H06+ CATATATGTCCATGTGTATGCTGCATTTAATGTATGTATTT
rJMSF001L21+ CATATATGT-CATGTGTATGCTGCATTTAATGTATGTATTT
rJMFF033A23+ CATATATGT-CATGTGTATGCTGCATTTAATGTATGTATTTTTCACATGTCATAATGCAT
                      ____________________________________________________________
consensus CATATATGT-CATGTGTATGCTGCATTTAATGTATGTATTTTTCACATGTCATAATGCAT