Previous Contig 009736:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032M23Sequence618014724gb:AK118585_18165549e-77Arabidopsis thaliana At2g28930 mRNA for putative protein kinase, complete cds, c321009736 (2)
JMSF024L01Sequence656005010 (6)sp|Q43082|HEM3_PEA3e-63Porphobilinogen deaminase, chloroplast precursor (EC 2.5.1.61) (PBG) (Hydroxymet690009736 (2)gb:AC079022_15417261e-45Oryza sativa chromosome 5 clone P0574H01, complete sequence.>gb:AC079356_1732528

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024L01+ CAACGAGGGTAATGGGCACTTA
                      ____________________________________________________________
consensus CAACGAGGGTAATGGGCACTTA
 
. : . : . : . : . : . :
rJMSF024L01+ TGGATATGCAGCTCCCGAATACTTAGCCACTGGTCATTTGACTACCAGGAGCGATGTGTA
                      ____________________________________________________________
consensus TGGATATGCAGCTCCCGAATACTTAGCCACTGGTCATTTGACTACCAGGAGCGATGTGTA
 
. : . : . : . : . : . :
rJMSF024L01+ TAGTTTTGGAGTTGTTCTTCTTGAAATGCTATCAGGTCGAAGAGCAATCGACAAGAATAG
                      ____________________________________________________________
consensus TAGTTTTGGAGTTGTTCTTCTTGAAATGCTATCAGGTCGAAGAGCAATCGACAAGAATAG
 
. : . : . : . : . : . :
rJMSF024L01+ ACCATCGGGAGAACACAACCTGGTAGAATGGGCTAAACCGTACTTGGCTATCAAACGTAA
                      ____________________________________________________________
consensus ACCATCGGGAGAACACAACCTGGTAGAATGGGCTAAACCGTACTTGGCTATCAAACGTAA
 
. : . : . : . : . : . :
rJMSF024L01+ AGTCCACCGAGTTGTGGATAACCGTCTTGAAGGGCAGTATTCACTGGATGTCGCCCAGAA
                      ____________________________________________________________
consensus AGTCCACCGAGTTGTGGATAACCGTCTTGAAGGGCAGTATTCACTGGATGTCGCCCAGAA
 
. : . : . : . : . : . :
rJMSF024L01+ AGTAGCTTTTATTGCCTTGCGGTGCCTATCCACCGATGCTAGGATTAGGCCTACCATGGA
                      ____________________________________________________________
consensus AGTAGCTTTTATTGCCTTGCGGTGCCTATCCACCGATGCTAGGATTAGGCCTACCATGGA
 
. : . : . : . : . : . :
rJMSF024L01+ CGACGTGGTTAGAGAACTGGAGAAGCTTAACGAGACTCGGGATATGGAAAACACCACCGG
                      ____________________________________________________________
consensus CGACGTGGTTAGAGAACTGGAGAAGCTTAACGAGACTCGGGATATGGAAAACACCACCGG
 
. : . : . : . : . : . :
rJMSF024L01+ CAAGCCCACTGGCAATGGTTCTAGACTTCGCAGACGAAGTACTGGTGATGCTGCCCGTTT
                      ____________________________________________________________
consensus CAAGCCCACTGGCAATGGTTCTAGACTTCGCAGACGAAGTACTGGTGATGCTGCCCGTTT
 
. : . : . : . : . : . :
rJMSF024L01+ AAACTCGCAAGTTTCATTTCCAAAACAATCTGCTTCTTCCCTCTTGCCAAACATGTCGCT
rJMFF032M23+ CCTCTTGCCAAACATGTCGCT
                      ____________________________________________________________
consensus AAACTCGCAAGTTTCATTTCCAAAACAATCTGCTTCTTCCCTCTTGCCAAACATGTCGCT
 
. : . : . : . : . : . :
rJMSF024L01+ GAAAACATCTGCTTGAGATCGATTTTCTGACTATACGATATGCACAATGTTGAAGATGAA
rJMFF032M23+ GAAAACATGTGCTTGAGATCGATTTTCTGACTATACGATATGCACAATGTTGAAGATGAA
                      ____________________________________________________________
consensus GAAAACATGTGCTTGAGATCGATTTTCTGACTATACGATATGCACAATGTTGAAGATGAA
 
. : . : . : . : . : . :
rJMSF024L01+ CCCTCCATTGATGAAAGGACTAACAGGTTAAGAATTACTTCTATCAGATTTAAGTCCTGT
rJMFF032M23+ CCCTCCATTGATGAAAGAACTAACAGGTTAAGAATTACTTCTATCAGATTTAAGTCCTGT
                      ____________________________________________________________
consensus CCCTCCATTGATGAAAGGACTAACAGGTTAAGAATTACTTCTATCAGATTTAAGTCCTGT
 
. : . : . : . : . : . :
rJMSF024L01+ AAATAGAATAATAGACTTTACAGATCAGTTAGAGTGTAATGTATCTATCAGATATGGGAT
rJMFF032M23+ AAATAGAATAATAGACTTTACAGATCAGTTAGAGTGTAATGTATCTATCAGATATGGGAT
                      ____________________________________________________________
consensus AAATAGAATAATAGACTTTACAGATCAGTTAGAGTGTAATGTATCTATCAGATATGGGAT
 
. : . : . : . : . : . :
rJMSF024L01+ CTCTCTCT
rJMFF032M23+ CTCTCTCTTTTTGCCTCAATTTCACACACTTGAAAAGAGCATTTGTGCACGGGTGGATGT
                      ____________________________________________________________
consensus CTCTCTCTTTTTGCCTCAATTTCACACACTTGAAAAGAGCATTTGTGCACGGGTGGATGT
 
. : . : . : . : . : . :
rJMFF032M23+ TGAATGGGCAAGTTGAAAGACTTTTAGATGATTCATGAGACAAATCATGTGTGTGCTAGA
                      ____________________________________________________________
consensus TGAATGGGCAAGTTGAAAGACTTTTAGATGATTCATGAGACAAATCATGTGTGTGCTAGA