Previous Contig 009735:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032M09Sequence621014722gb:AY080658_15683902e-59Arabidopsis thaliana unknown protein (At4g31750) mRNA, complete cds.>gb:AY133761667009735 (2)gb:AB083482_15242221e-60Mesembryanthemum crystallinum MPC9 mRNA for protein phosphatase 2C, complete cds
JMFF034L15Sequence553014758gb:AY080658_15683901e-60Arabidopsis thaliana unknown protein (At4g31750) mRNA, complete cds.>gb:AY133761401009735 (2)gb:AB083482_15242222e-19Mesembryanthemum crystallinum MPC9 mRNA for protein phosphatase 2C, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF032M09+ TGGGACTG
                      ____________________________________________________________
consensus TGGGACTG
 
. : . : . : . : . : . :
rJMFF032M09+ CTATTGCTGTTTCTCGGGATCACAAGCCAGACCAGAAGGATGAGCGACAACGTATTGAAG
                      ____________________________________________________________
consensus CTATTGCTGTTTCTCGGGATCACAAGCCAGACCAGAAGGATGAGCGACAACGTATTGAAG
 
. : . : . : . : . : . :
rJMFF032M09+ ATGCTGGAGGTTTTGTCATGTGGGCAGGTACCTGGAGAGTTGGAGGTGTGCTTGCTGTTT
                      ____________________________________________________________
consensus ATGCTGGAGGTTTTGTCATGTGGGCAGGTACCTGGAGAGTTGGAGGTGTGCTTGCTGTTT
 
. : . : . : . : . : . :
rJMFF032M09+ CCCGAGCATTTGGTGATAGGCTTTTGAAGCAGTATGTTGTCGCAGATCCAGAAATCAAGG
                      ____________________________________________________________
consensus CCCGAGCATTTGGTGATAGGCTTTTGAAGCAGTATGTTGTCGCAGATCCAGAAATCAAGG
 
. : . : . : . : . : . :
rJMFF034L15+ GAGTTCCTTATCCTTGCAAGTGACGGGCTGTGGGATG
rJMFF032M09+ AGGAAAAGGTTGACAGTTCACTTGAGTTCCTTATCCTTGCAAGTGACGGGCTGTGGGATG
                      ____________________________________________________________
consensus AGGAAAAGGTTGACAGTTCACTTGAGTTCCTTATCCTTGCAAGTGACGGGCTGTGGGATG
 
. : . : . : . : . : . :
rJMFF034L15+ TAGTGACAAATGAGGAAGCTGTGTCGATGGTCAAGCCCATCCCGGAACCTGAGGAAGCAG
rJMFF032M09+ TAGTGACAAATGAGGAAGCTGTGTCGATGGTCAAGCCCATCCCGGAACCTGAGGAAGCAG
                      ____________________________________________________________
consensus TAGTGACAAATGAGGAAGCTGTGTCGATGGTCAAGCCCATCCCGGAACCTGAGGAAGCAG
 
. : . : . : . : . : . :
rJMFF034L15+ CAAAGAGACTAATGCAAGAAGCTTATCAAAGAGGCAGNGCAGACAACATCNCCATTATCA
rJMFF032M09+ CAAAGAGACTAATGCAAGAAGCTTATCAAAGAGGCAGCGCAGACAACATCACCATTATCA
                      ____________________________________________________________
consensus CAAAGAGACTAATGCAAGAAGCTTATCAAAGAGGCAGCGCAGACAACATCACCATTATCA
 
. : . : . : . : . : . :
rJMFF034L15+ TAGNGCGTTTTTTGGCTTACGAAGGGGATGCCTNTCACAGNGGCTNTGGTTGAGGAGTGC
rJMFF032M09+ TAGTGCGTTTTCTGGCTAACGAAGGGGATGCCTCTCACAGTGGCTCTGGTTGAGGAGTGC
                      ____________________________________________________________
consensus TAGTGCGTTTTTTGGCTTACGAAGGGGATGCCTCTCACAGTGGCTCTGGTTGAGGAGTGC
 
. : . : . : . : . : . :
rJMFF034L15+ TATNTTTCCGCAAGGACTAATTGCCGATAATATGAATAGGATTGTAAGTAAATATAGAAG
rJMFF032M09+ TATCTTTCCGCAAGGACTAATTGCCGATAATATGAATAGGATTGTAAGTAAATATAGAAG
                      ____________________________________________________________
consensus TATCTTTCCGCAAGGACTAATTGCCGATAATATGAATAGGATTGTAAGTAAATATAGAAG
 
. : . : . : . : . : . :
rJMFF034L15+ AAGTAAAAAAAAAACAGACTTCTGGGTGTTATTTAATAGAGAGACGACCTTAGACAGGGA
rJMFF032M09+ AAGT-AAAAAAAAACAGACTTCTGGGTGTTATTTAATAGAGAGACGACCTTAGACAGGGA
                      ____________________________________________________________
consensus AAGTAAAAAAAAAACAGACTTCTGGGTGTTATTTAATAGAGAGACGACCTTAGACAGGGA
 
. : . : . : . : . : . :
rJMFF034L15+ ACATGTCTGACTTGCAGCCAGCTTATCAAGAAGTTAAACGAGTGAGTGAACCTACCTATA
rJMFF032M09+ ACATGTCTGACTTGCAGCCAGCTTATCAAGAAGTTAAACGAGTGAGTGAACCTACCTATA
                      ____________________________________________________________
consensus ACATGTCTGACTTGCAGCCAGCTTATCAAGAAGTTAAACGAGTGAGTGAACCTACCTATA
 
. : . : . : . : . : . :
rJMFF034L15+ TATA
rJMFF032M09+ TATATATATGAGTAGCGTCCGTGATTTATTATTTGTTCTAAATTTAACTGTCATTTCATT
                      ____________________________________________________________
consensus TATATATATGAGTAGCGTCCGTGATTTATTATTTGTTCTAAATTTAACTGTCATTTCATT