Previous Contig 009732:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003H14Sequence590000143 (7)gb:NTA305044_16913301e-49Nicotiana tabacum mRNA for vacuolar invertase (vi gene).777009732 (5)gb:AY037938_15601741e-84Ipomoea batatas soluble acid invertase Ib2FRUCT3 (Ibbfruct3) mRNA, complete cds.
JMFF020F16Sequence611000143 (7)gb:TOMBFSD_17256145e-53Tomato mRNA for beta-fructosidase, complete cds.>gb:AF465612_1802146 Lycopersico737009732 (5)gb:AY037938_15601747e-82Ipomoea batatas soluble acid invertase Ib2FRUCT3 (Ibbfruct3) mRNA, complete cds.
JMFF025B08Sequence574000143 (7)sp|P49175|INV1_MAIZE8e-47Beta-fructofuranosidase 1 precursor (EC 3.2.1.26) (Sucrose-6-phosphate hydrolase660009732 (5)gb:AY037938_15601741e-67Ipomoea batatas soluble acid invertase Ib2FRUCT3 (Ibbfruct3) mRNA, complete cds.
JMFF032L23Sequence597000143 (7)gb:NTA305044_16913304e-51Nicotiana tabacum mRNA for vacuolar invertase (vi gene).800009732 (5)gb:AY037938_15601742e-75Ipomoea batatas soluble acid invertase Ib2FRUCT3 (Ibbfruct3) mRNA, complete cds.
JMFF038P16Sequence661000143 (7)gb:TOMBFSD_17256143e-61Tomato mRNA for beta-fructosidase, complete cds.>gb:AF465612_1802146 Lycopersico777009732 (5)gb:AY037938_15601742e-87Ipomoea batatas soluble acid invertase Ib2FRUCT3 (Ibbfruct3) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF038P16+ CACTGCATTTAGA
rJMFF003H14+ ACTGCATTTAGA
                      ____________________________________________________________
consensus CACTGCATTTAGA
 
. : . : . : . : . : . :
rJMFF038P16+ CAAGAAGACAGGAAGTCA-TCTGCTTCAGTGGCCAATTGAAGAAGTAAAGAGGTTGAGAT
rJMFF003H14+ CAAGAAGACAGGAAGTCATTCTGCTTCAGTGGCCAATTGAAGAAGTAAAGAGGTTGAGAT
rJMFF020F16+ CCAATTGAAGAAGTAAAGAGGTTGAGAT
rJMFF032L23+ TGAAGAAGTAAAGAGGTTGAGAT
                      ____________________________________________________________
consensus CAAGAAGACAGGAAGTCATTCTGCTTCAGTGGCCAATTGAAGAAGTAAAGAGGTTGAGAT
 
. : . : . : . : . : . :
rJMFF038P16+ CAGGCGACCCCATTGTCACAAAGGTCAATCTTCAACCAGGTGAAATCCTACCAATCCACA
rJMFF025B08+ CAGGTGAAATCNTACCAATCCACA
rJMFF003H14+ CAGGCGACCCCATTGTCACAAAGGTCAATCTTCAACCAGGTGAAATCCTACCAATCCACA
rJMFF020F16+ CAGGCGACCCCATTGTCACAAAGGTCAATCTTCAACCAGGTGAAATCCTACCAATCCACA
rJMFF032L23+ CAGGCGACCCCATTGTCACAAAGGTCAATCTTCAACCAGGTGAAATCCTACCAATCCACA
                      ____________________________________________________________
consensus CAGGCGACCCCATTGTCACAAAGGTCAATCTTCAACCAGGTGAAATCCTACCAATCCACA
 
. : . : . : . : . : . :
rJMFF038P16+ TT-CCAGCTGCTGCGCAGTTAGACATTATTGCCTCGTTTGAAGTGATGAATGAAGAGGCA
rJMFF025B08+ TTCCCAGCTGCTGCGCAGTTAGACATTATTGCCTCGTTTGAAGTGATGAATGAAGAGGCA
rJMFF003H14+ TT-CCAGCTGCTGCGCAGTTAGACATTATTGCCTCGTTTGAAGTGATGAATGAAGAGGCA
rJMFF020F16+ TT-CCAGCTGCTGCGCAGTTAGACATTATTGCCTCGTTTGAAGTGATGAATGAAGAGGCA
rJMFF032L23+ TT-CCAGCTGCTGCGCAGTTAGACATTATTGCCTCGTTTGAAGTGATGAATGAAGAGGCA
                      ____________________________________________________________
consensus TT-CCAGCTGCTGCGCAGTTAGACATTATTGCCTCGTTTGAAGTGATGAATGAAGAGGCA
 
. : . : . : . : . : . :
rJMFF038P16+ GTCGAAGGTGAAGGCGATTTTAGGTACAACTGCAGTAGCAGTGGTGGTGCTGTTAAGAGA
rJMFF025B08+ GTCGAAGGTGAAGGCGATTTTAGGTACAACTGCAGTAGCAGTGGTGGTGCTGTTAAGGGA
rJMFF003H14+ GTCGAAGGTGAAGGCGATTTTAGGTACAACTGCAGTAGCAGTGGTGGTGCTGTTAAGAGA
rJMFF020F16+ GTCGAAGGTGAAGGCGATTTTAGGTACAACTGCAGTAGCAGTGGTGGTGCTGTTAAGAGA
rJMFF032L23+ GTCGAAGGTGAAGGCGATTTTAGGTACAACTGCAGTAGCAGTGGTGGTGCTGTTAAGAGA
                      ____________________________________________________________
consensus GTCGAAGGTGAAGGCGATTTTAGGTACAACTGCAGTAGCAGTGGTGGTGCTGTTAAGAGA
 
. : . : . : . : . : . :
rJMFF038P16+ GGCGCTTTGGGGCCATTTGGTTTGGTAGTTGCAGCTGATGAAACACTTGCCGAGCTAACG
rJMFF025B08+ GGCGCTTTGGGGCCATTTGGTTTGGTAGTTGCAGCTGATGAAACACTTGCCGAGCTAACG
rJMFF003H14+ GGCGCTTTGGGGCCATTTGGTTTGGTAGTTGCAGCTGATGAAACACTTGCCGAGCTAACG
rJMFF020F16+ GGCGCTTTGGGGCCATTTGGTTTGGTAGTTGCAGCTGATGAAACACTTGCCGAGCTAACG
rJMFF032L23+ GGCGCTTTGGGGCCATTTGGTTTGGTAGTTGCAGCTGATGAAACACTTGCCGAGCTAACG
                      ____________________________________________________________
consensus GGCGCTTTGGGGCCATTTGGTTTGGTAGTTGCAGCTGATGAAACACTTGCCGAGCTAACG
 
. : . : . : . : . : . :
rJMFF038P16+ CCTGTTTACTTCTATGTTCAAAAAGGTGGTGATGGGAAGGTAGAGACTCATTTCTGCACT
rJMFF025B08+ CCTGTTTACTTCTATGTTCAAAAAGGTGGTGATGGGAAGGTAGAGACTCATTTCTGCACT
rJMFF003H14+ CCTGTTTACTTCTATGTTCAAAAAGGTGGTGATGGGAAGGTAGAGACTCATTTCTGCACT
rJMFF020F16+ CCTGTTTACTTCTATGTTCAAAAAGGTGGTGATGGGAAGGTAGAGACTCATTTCTGCACT
rJMFF032L23+ CCTGTTTACTTCTATGTTCAAAAAGGTGGTGATGGGAAGGTAGAGACTCATTTCTGCACT
                      ____________________________________________________________
consensus CCTGTTTACTTCTATGTTCAAAAAGGTGGTGATGGGAAGGTAGAGACTCATTTCTGCACT
 
. : . : . : . : . : . :
rJMFF038P16+ GACTTGACAAGGTCATCAGAAGCATCTGGAGTTACGAAAGAAGTTTATGGTAGCACCGTA
rJMFF025B08+ GACTTGACAAGGTCATCAGAAGCATCTGGAGTTACGAAAGAAGTTTATGGTAGCACCGTA
rJMFF003H14+ GACTTGACAAGGTCATCAGAAGCATCTGGAGTTACGAAAGAAGTTTATGGTAGCACCGTA
rJMFF020F16+ GACTTGACAAGGTCATCAGAAGCATCTGGAGTTACGAAAGAAGTTTATGGTAGCACCGTA
rJMFF032L23+ GACTTGACAAGGTCATCAGAAGCATCTGGAGTTACGAAAGAAGTTTATGGTAGCACCGTA
                      ____________________________________________________________
consensus GACTTGACAAGGTCATCAGAAGCATCTGGAGTTACGAAAGAAGTTTATGGTAGCACCGTA
 
. : . : . : . : . : . :
rJMFF038P16+ CCTGTTATTGATGATGAAAAATATTCAGCAAGAATATTGGTTGACCATTCAATCGTGGAG
rJMFF025B08+ CCTGTTATTGATGATGAAAAATATTCAGCAAGAATATTGGTTGACCATTCAATCGTGGAG
rJMFF003H14+ CCTGTTATTGATGATGAAAAATATTCAGCAAGAATATTGGTTGACCATTCAATCGTGGAG
rJMFF020F16+ CCTGTTATTGATGATGAAAAATATTCAGCAAGAATATTGGTTGACCATTCAATCGTGGAG
rJMFF032L23+ CCTGTTATTGATGATGAAAAATATTCAGCAAGAATATTGGTTGACCATTCAATCGTGGAG
                      ____________________________________________________________
consensus CCTGTTATTGATGATGAAAAATATTCAGCAAGAATATTGGTTGACCATTCAATCGTGGAG
 
. : . : . : . : . : . :
rJMFF038P16+ AGTTTTGGTCAAGGAGGAAGAACAGTTATAACATCAAGAATATATCCAACCAAAGCAATA
rJMFF025B08+ AGTTTTGGTCAAGGAGGAAGAACAGTTATAACATCAAGAATATATCCAACCAAAGCAATA
rJMFF003H14+ AGTTTTGGTCAAGGAGGAAGAACAGTTATAACATCAAGAATATATCCAACCAAAGCAATA
rJMFF020F16+ AGTTTTGGTCAAGGAGGAAGAACAGTTATAACATCAAGAATATATCCAACCAAAGCAATA
rJMFF032L23+ AGTTTTGGTCAAGGAGGAAGAACAGTTATAACATCAAGA--ATATCCAACCAAAGCAATA
                      ____________________________________________________________
consensus AGTTTTGGTCAAGGAGGAAGAACAGTTATAACATCAAGAATATATCCAACCAAAGCAATA
 
. : . : . : . : . : . :
rJMFF038P16+ TATGAAGCGGCAAGAGTCTTCTTGTTCAACAATGCCACAGGGACAAGTGTTAAAGCGTCT
rJMFF025B08+ TATGAAGCGGCAAGAGTCTTCTTGTTCAACAATGCCACAGGGACAAGTGTTAAAGCGTCT
rJMFF003H14+ TATGAAGCGGCAAGAGTCTTCTTGTTCAACAATGCCACAGGGACAAGTGTTAAAGCGTCT
rJMFF020F16+ TATGAAGCGGCAAGAGTCTTCTTGTTCAACAATGCCACAGGGACAAGTGTTAAAGCGTCT
rJMFF032L23+ TATGAAGCGGCAAGAGTCTTCTTGTTCAACAATGCCACAGGGACAAGTGTTAAAGCGTCT
                      ____________________________________________________________
consensus TATGAAGCGGCAAGAGTCTTCTTGTTCAACAATGCCACAGGGACAAGTGTTAAAGCGTCT
 
. : . : . : . : . : . :
rJMFF038P16+ GTGAAGATATGGCAAATGAATTCAGCTGATATTAAGCCATTCCCATTTTGATCAATTCTT
rJMFF025B08+ GTGAAGATATGGCAAATGAATTCAGCTGATATTAAGCCATTCCCATTTTGATCAATTCTT
rJMFF003H14+ GTGAAGATATGGCAAATGAATTCAGCTGATATTAAGCCATTCCCATTTTGATCAATTCTT
rJMFF020F16+ GTGAAGATATGGCAAATGAATTCAGCTGATATTAAGCCATTCCCATTTTGATCAATTCTT
rJMFF032L23+ GTGAAGATATGGCAAATGAATTCAGCTGATATTAAGCCATTCCCATTTTGATCAATTCTT
                      ____________________________________________________________
consensus GTGAAGATATGGCAAATGAATTCAGCTGATATTAAGCCATTCCCATTTTGATCAATTCTT
 
. : . : . : . : . : . :
rJMFF038P16+ GAATTGTTTGCTTCCAATTCACTTTCTCATCTGCCTTAGCTATTATATGAATAATTGAAG
rJMFF025B08+ GAATTGTTTGCTTCCAATTCACTTTCTCATCTGCCTTAGCTATTATATGAATAATTGAAG
rJMFF003H14+ GAATTGTTTGCTTCCAATTCACTTTCTCATCTGCCTTAGCTATTATATGAATAATTGAAG
rJMFF020F16+ GAATTGTTTGCTTCCAATTCACTTTCTCATCTGCCTTAGCTATTATATGAATAATTGAAG
rJMFF032L23+ GAATTGTTTGCTTCCAATTCACTTTCTCATCTGCCTTAGCTATTATATGAATAATTGAAG
                      ____________________________________________________________
consensus GAATTGTTTGCTTCCAATTCACTTTCTCATCTGCCTTAGCTATTATATGAATAATTGAAG
 
. : . : . : . : . : . :
rJMFF038P16+ CTTGTATATTAGACTCAATCTCACACTAACAAGTGGTAT
rJMFF025B08+ CTTGTATATTAGACTCAATCTCACACTAACAAGTGG
rJMFF003H14+ CTTGTATATTAGACTCAATCTCACACTAACAAGTGGTAT
rJMFF020F16+ CTTGTATATTAGACTCAATCTCACACTAACAAGTGGTAT
rJMFF032L23+ CTTGTATATTAGACTCAATCTCACACTAACAAGTGGTATGCCAGATTCCATGCTTGATTT
                      ____________________________________________________________
consensus CTTGTATATTAGACTCAATCTCACACTAACAAGTGGTATGCCAGATTCCATGCTTGATTT
 
. : . : . : . : . : . :
rJMFF032L23+ ATGTGTATTCCAAGGGTGTGTTTGGTTACGTTCGAACATGGGAATGGAATGATAATCAAA
                      ____________________________________________________________
consensus ATGTGTATTCCAAGGGTGTGTTTGGTTACGTTCGAACATGGGAATGGAATGATAATCAAA