Previous Contig 009731:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022J15Sequence504001118 (2)gb:AY056811_15638609e-16Arabidopsis thaliana AT5g60720/mup24_130 mRNA, complete cds.>gb:BT002647_1636250746009731 (2)gb:AY056811_15638609e-62Arabidopsis thaliana AT5g60720/mup24_130 mRNA, complete cds.>gb:BT002647_1636250
JMFF032L20Sequence510001118 (2)gb:AY056811_15638607e-19Arabidopsis thaliana AT5g60720/mup24_130 mRNA, complete cds.>gb:BT002647_1636250728009731 (2)gb:AY056811_15638604e-57Arabidopsis thaliana AT5g60720/mup24_130 mRNA, complete cds.>gb:BT002647_1636250

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF022J15+ TTAGCATTCTGGATCAACATGTACAATG
rJMFF032L20+ GTACAATG
                      ____________________________________________________________
consensus TTAGCATTCTGGATCAACATGTACAATG
 
. : . : . : . : . : . :
rJMFF022J15+ CTTGTATCATGCATGGATTTCTTCAATATGGAGCTCCATCTAGTTCTACGCCAGAAAAAC
rJMFF032L20+ CTTGTATCATGCATGGATTTCTTCAATATGGAGCTCCATCTAGTTCTACGCCAGAAAAAC
                      ____________________________________________________________
consensus CTTGTATCATGCATGGATTTCTTCAATATGGAGCTCCATCTAGTTCTACGCCAGAAAAAC
 
. : . : . : . : . : . :
rJMFF022J15+ TGGCATCACTTATCAACAAGGCGACATTAAACATCGGAGGTCATACAATAAACGCTCAAG
rJMFF032L20+ TGGCATCACTTATCAACAAGGCGACATTAAACATCGGAGGTCATACAATAAACGCTCAAG
                      ____________________________________________________________
consensus TGGCATCACTTATCAACAAGGCGACATTAAACATCGGAGGTCATACAATAAACGCTCAAG
 
. : . : . : . : . : . :
rJMFF022J15+ GTATTGAGCATTATATTCTGAGAAAACCACTCGGAAAAGAGGGTAAGCAAGATGAGAAGG
rJMFF032L20+ GTATTGAGCATTATATTCTGAGAAAACCACTCGGAAAAGAGGGTAAGCAAGATGAGAAGG
                      ____________________________________________________________
consensus GTATTGAGCATTATATTCTGAGAAAACCACTCGGAAAAGAGGGTAAGCAAGATGAGAAGG
 
. : . : . : . : . : . :
rJMFF022J15+ GGAGCACAATTCCTTCACTCTATTGTCTAGGCTCCCTCGATCCAAATATCACATTCGCAT
rJMFF032L20+ GGAGCACAATTCCTTCACTCTATTGTCTAGGCTCCCTCGATCCAAATATCACATTCGCAT
                      ____________________________________________________________
consensus GGAGCACAATTCCTTCACTCTATTGTCTAGGCTCCCTCGATCCAAATATCACATTCGCAT
 
. : . : . : . : . : . :
rJMFF022J15+ TGTGTTGTGGCACTCGTTCCTCACCCGCTGTGAAAATATACACGGCAGAAGGGGTGTCGG
rJMFF032L20+ TGTGTTGTGGCACTCGTTCCTCACCCGCTGTGAAAATATACACGGCAGAAGGGGTGTCGG
                      ____________________________________________________________
consensus TGTGTTGTGGCACTCGTTCCTCACCCGCTGTGAAAATATACACGGCAGAAGGGGTGTCGG
 
. : . : . : . : . : . :
rJMFF022J15+ CGGAGCTAGAAAAATCGAAGCTGGAGTATTTACAGGCTTCGATCATCGTGACGAACACGA
rJMFF032L20+ CGGAGCTAGAAAAATCGAAGCTGGAGTATTTACAGGCTTCGATCATCGTGACGAACACGA
                      ____________________________________________________________
consensus CGGAGCTAGAAAAATCGAAGCTGGAGTATTTACAGGCTTCGATCATCGTGACGAACACGA
 
. : . : . : . : . : . :
rJMFF022J15+ AGAAGATTGCGTTGCCGGAGCTTCTGCTAAGAAACATGCGTGACTTTGCGCAGGACTTGG
rJMFF032L20+ AGAAGATTGCGTTGCCGGAGCTTCTGCTAAGAAACATGCGTGACTTTGCGCAGGACTTGG
                      ____________________________________________________________
consensus AGAAGATTGCGTTGCCGGAGCTTCTGCTAAGAAACATGCGTGACTTTGCGCAGGACTTGG
 
. : . : . : . : . : . :
rJMFF022J15+ ATTCATTGCTGGATTGGGTTTGCCAGCAGCTACCCACGTCAGGATCTCTCAGAAAATCCA
rJMFF032L20+ ATTCATTGCTGGATTGGGTTTGCCAGCAGCTACCCACGTCAGGATCTCTCAGAAAATCCA
                      ____________________________________________________________
consensus ATTCATTGCTGGATTGGGTTTGCCAGCAGCTACCCACGTCAGGATCTCTCAGAAAATCCA
 
. : . : . : . : . : . :
rJMFF022J15+ TCGTTGATTGCTTCAGGGGCGTCCATGGCGCCGCCAAATCGTCCGCCATTGTTGAGAAAA
rJMFF032L20+ TCGTTGATTGCTTCAGGGGCGTCCATGGCGCCGCCAAATCGTCCGCCATTGTTGAGAAAA
                      ____________________________________________________________
consensus TCGTTGATTGCTTCAGGGGCGTCCATGGCGCCGCCAAATCGTCCGCCATTGTTGAGAAAA
 
. : . : . : . : . : . :
rJMFF022J15+ TACCTTATGAATTCGACTTCCAGTATCTTTTATCTGTATGATGAATTACTGATTTTTGCT
rJMFF032L20+ TACCTTATGAATTCGACTTCCAGTATCTTTTATCTGTATGATGAATTACTGATTTTTGCT
                      ____________________________________________________________
consensus TACCTTATGAATTCGACTTCCAGTATCTTTTATCTGTATGATGAATTACTGATTTTTGCT
 
. : . : . : . : . : . :
rJMFF022J15+ ATAAATCTTAAATATGGTGTACATTATAGATATTGATTGCGTAACAATCATAACAGTTAA
rJMFF032L20+ ATAAATCTTAAATATGGTGTACATTATAGATATTGATTGCGTAACAATCATAACAGTTAA
                      ____________________________________________________________
consensus ATAAATCTTAAATATGGTGTACATTATAGATATTGATTGCGTAACAATCATAACAGTTAA
 
. : . : . : . : . : . :
rJMFF022J15+ AATTTATGTTTACCATTATTGTCTCGGGAAGTTTTTGACACTTTTGATTTCACGATTA
rJMFF032L20+ AATTTATGTTTACCATTATTGTCTCGGGAAGTTTTTGACACTTTTGATTTCACGATTATA
                      ____________________________________________________________
consensus AATTTATGTTTACCATTATTGTCTCGGGAAGTTTTTGACACTTTTGATTTCACGATTATA