Previous Contig 009724:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028P20Sequence569000107 (4)gb:AK117504_18155369e-11Arabidopsis thaliana At3g26780 mRNA for unknown protein, complete cds, clone: RA123009724 (3)
JMFF032J09Sequence589000107 (4)gb:AK117504_18155362e-14Arabidopsis thaliana At3g26780 mRNA for unknown protein, complete cds, clone: RA757009724 (3)gb:AY082377_15691774e-28Silene conica SlX4-like protein mRNA, partial cds.
JMFF044B07Sequence647000107 (4)gb:AK117504_18155364e-21Arabidopsis thaliana At3g26780 mRNA for unknown protein, complete cds, clone: RA659009724 (3)gb:AB016889_15131835e-25Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MDJ14.>gb:AK117416_181

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF044B07+ CAACTGGA
rJMFF032J09+ TGGCAAAAGTAGGCTGCAGATGGTGGCTTCAACTGGA
                      ____________________________________________________________
consensus TGGCAAAAGTAGGCTGCAGATGGTGGCTTCAACTGGA
 
. : . : . : . : . : . :
rJMFF044B07+ GATCAGGCTGATGATGAGATGTCTCCTCGAGTGCAAGTCAACCCCAGCCCGGTTCGTGAC
rJMFF032J09+ GATCAGGCTGATGATGAGATGTCTCCTCGAGTGCAAGTCAACCCCAGCCCGGTTCGTGAC
                      ____________________________________________________________
consensus GATCAGGCTGATGATGAGATGTCTCCTCGAGTGCAAGTCAACCCCAGCCCGGTTCGTGAC
 
. : . : . : . : . : . :
rJMFF044B07+ ATAAATACCAAAAGCGCCTCTTCTAGTGTTTCTTCTTCGTCTTCTTCTTCTTTTTCGTGT
rJMFF032J09+ ATAAATACCAAAAGCGCCTCTTCTAGTGTTTCTTCTTCGTCTTCTTCTTCTTTTTCGTGT
                      ____________________________________________________________
consensus ATAAATACCAAAAGCGCCTCTTCTAGTGTTTCTTCTTCGTCTTCTTCTTCTTTTTCGTGT
 
. : . : . : . : . : . :
rJMFF044B07+ GTAGGCATCTTCACCCATGCAATCCCAATTAAGTGTGTTGTTACCGGGCTTCTTGGATGC
rJMFF032J09+ GTGGGCATCTTCACCCATGCAATCCCAATTAAGTGTGTTGTTACCGGGCTTCTTGGATGC
                      ____________________________________________________________
consensus GTGGGCATCTTCACCCATGCAATCCCAATTAAGTGTGTTGTTACCGGGCTTCTTGGATGC
 
. : . : . : . : . : . :
rJMFF044B07+ AGTGCAGTAATGTCGAGTAAGATCTGTGTAGACGATTCTTCAGTAACCGTGTTACAACAT
rJMFF032J09+ AGTGCAGTAATGTCGAGTAAGATCTGTGTAGACGATTCTTCAGTAACCGTGTTACAACAT
                      ____________________________________________________________
consensus AGTGCAGTAATGTCGAGTAAGATCTGTGTAGACGATTCTTCAGTAACCGTGTTACAACAT
 
. : . : . : . : . : . :
rJMFF044B07+ TCATGGAAAATGGGATGGCAAATAAAGAGATTGAATGATACATCACATCTTAGGCTTCTA
rJMFF032J09+ TCATGGAAAATGGGATGGCAAATAAAGAGATTGAATGATACATCACATCTTAGGCTTCTA
                      ____________________________________________________________
consensus TCATGGAAAATGGGATGGCAAATAAAGAGATTGAATGATACATCACATCTTAGGCTTCTA
 
. : . : . : . : . : . :
rJMFF044B07+ TAGTAAATTATTACTAGTGGATAAGATTGTTGCCAGAGGAAGTCTTCAGCCAAGAAAAAT
rJMFF032J09+ TAGTAAATTATTACTAGTGGATAAGATTGTTGCCAGAGGAAGTCTTCAGCCAAGAAAAAT
                      ____________________________________________________________
consensus TAGTAAATTATTACTAGTGGATAAGATTGTTGCCAGAGGAAGTCTTCAGCCAAGAAAAAT
 
. : . : . : . : . : . :
rJMFF044B07+ AAACTTGGGGTTGCTTTTGGTTGAGATCTGAGAACCACTAAAGCAGAGTGATTGATTGAA
rJMFF028P20+ ATCTGAGAACCACTAAAGCAGAGTGATTGATTGAA
rJMFF032J09+ AAACTTGGGGTTGCTTTTGGTTGAGATCTGAGAACCACTAAAGCAGAGTGATTGATTGAA
                      ____________________________________________________________
consensus AAACTTGGGGTTGCTTTTGGTTGAGATCTGAGAACCACTAAAGCAGAGTGATTGATTGAA
 
. : . : . : . : . : . :
rJMFF044B07+ TGTATATTCCACGGCTCCTCCACATTTCAAGTTTGGAAAATACCTTTTGGTTATTGTAAG
rJMFF028P20+ TGTATATTCCACGGCTCCTCCACATTTCAAGTTTGGAAAATACCTTTTGGTTATTGTAAG
rJMFF032J09+ TGTATATTCCACGGCTCCTCCACATTTCAAGTTTGGAAAATACCTTTTGGTTATTGTAAG
                      ____________________________________________________________
consensus TGTATATTCCACGGCTCCTCCACATTTCAAGTTTGGAAAATACCTTTTGGTTATTGTAAG
 
. : . : . : . : . : . :
rJMFF044B07+ CCTTGGCTTGGCTATATTTATTTCACACTGAATTGGGAATGGTGGTAGAGTTGTAATCAT
rJMFF028P20+ CCTTGGCTTGGCTATATTTATTTCACAC
rJMFF032J09+ CCTTGGCTTGGCTATATTTATTTCACACTGAATTGGGAATGGTGGTAGAGTTGTAATCAT
                      ____________________________________________________________
consensus CCTTGGCTTGGCTATATTTATTTCACACTGAATTGGGAATGGTGGTAGAGTTGTAATCAT
 
. : . : . : . : . : . :
rJMFF044B07+ GGTTTTGGTGATTGTCTTGTTTTGTAACTTTAACAATTGTTGTTAAATGTGATACGGAGT
rJMFF032J09+ GGTTTTGGTGATTGTCTTGTTTTGTAACTTTAACAATTGTTGTTAAATGTGATACGGAGT
                      ____________________________________________________________
consensus GGTTTTGGTGATTGTCTTGTTTTGTAACTTTAACAATTGTTGTTAAATGTGATACGGAGT
 
. : . : . : . : . : . :
rJMFF044B07+ GCTACATCA
rJMFF032J09+ GCTACATCATATACTCAGGTCTACATCTACTGCTGGAAGAAGAAGAAGTGGGGTATGACT
                      ____________________________________________________________
consensus GCTACATCATATACTCAGGTCTACATCTACTGCTGGAAGAAGAAGAAGTGGGGTATGACT
 
. : . : . : . : . : . :
rJMFF032J09+ TGTCATCAAATTACATTGAACTCCGACCTATTTGAGTTGATAAATAAAGAGTATTATATT
                      ____________________________________________________________
consensus TGTCATCAAATTACATTGAACTCCGACCTATTTGAGTTGATAAATAAAGAGTATTATATT