Previous Contig 009723:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006O04Sequence621000524 (4)gb:AF417576_17982958e-78Euphorbia esula growth-on protein GRO10 (Gro10) mRNA, complete cds.785009723 (4)gb:AF417576_1798295e-101Euphorbia esula growth-on protein GRO10 (Gro10) mRNA, complete cds.
JMFF009N22Sequence544000524 (4)gb:AF417576_17982951e-53Euphorbia esula growth-on protein GRO10 (Gro10) mRNA, complete cds.251009723 (4)pir|D86147|D861475e-05T1N6.3 protein - Arabidopsis thaliana>gb:AE005172_889213 Arabidopsis thaliana ch
JMFF032J02Sequence528000524 (4)gb:AF417576_17982951e-50Euphorbia esula growth-on protein GRO10 (Gro10) mRNA, complete cds.688009723 (4)gb:AF417576_17982957e-86Euphorbia esula growth-on protein GRO10 (Gro10) mRNA, complete cds.
JMFF033P07Sequence569000524 (4)gb:AF417576_17982951e-59Euphorbia esula growth-on protein GRO10 (Gro10) mRNA, complete cds.788009723 (4)gb:AF417576_1798295e-101Euphorbia esula growth-on protein GRO10 (Gro10) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006O04+ TTCTGCAT
rJMFF033P07+ GTTCTGCAT
                      ____________________________________________________________
consensus GTTCTGCAT
 
. : . : . : . : . : . :
rJMFF006O04+ AGCTATTGCAGTNNTATGGGCAGTCTACAGAACATCATCATTTGCATGGATAGGTCAAGA
rJMFF033P07+ AGCTATTGCAGTTTTATGGGTAGTCTACAGAACATCATCATTTGCATGGATAGGTCAAGA
                      ____________________________________________________________
consensus AGCTATTGCAGTTTTATGGGTAGTCTACAGAACATCATCATTTGCATGGATAGGTCAAGA
 
. : . : . : . : . : . :
rJMFF006O04+ TGTACTTGGCATTGCGCTTATTATCACTGTTCTTCAGATTGTACGGATACNTAATCTTAA
rJMFF033P07+ TGTACTTGGCATTGCGCTTATTATCACTGTTCTTCAGATTGTACGGATACCTAATCTTAA
rJMFF032J02+ TTCAGATTGTACGGATACCTAATCTTAA
                      ____________________________________________________________
consensus TGTACTTGGCATTGCGCTTATTATCACTGTTCTTCAGATTGTACGGATACCTAATCTTAA
 
. : . : . : . : . : . :
rJMFF006O04+ GGTGGGAACAGTACTACTGGGTTGCGCCTTCTTGTACGACATATTTTGGGTGTTTGCTTC
rJMFF033P07+ GGTGGGAACAGTACTACTGGGTTGCGCCTTCTTGTACGACATATTTTGGGTGTTTGCTTC
rJMFF032J02+ GGTGGGAACAGTACTACTGGGTTGCGCCTTCTTGTACGACATATTTTGGGTGTTTGCTTC
                      ____________________________________________________________
consensus GGTGGGAACAGTACTACTGGGTTGCGCCTTCTTGTACGACATATTTTGGGTGTTTGCTTC
 
. : . : . : . : . : . :
rJMFF006O04+ CAAGAAGCTGTTCCATGAAAGTGTGATGATTGTGGTAGCTCGTGGTGATAGAAGCGGCGA
rJMFF033P07+ CAAGAAGCTGTTCCATGAAAGTGTGATGATTGTGGTAGCTCGTGGTGATAGAAGCGGCGA
rJMFF032J02+ CAAGAAGCTGTTCCATGAAAGTGTGATGATTGTGGTAGCTCGTGGTGATAGAAGCGGCGA
                      ____________________________________________________________
consensus CAAGAAGCTGTTCCATGAAAGTGTGATGATTGTGGTAGCTCGTGGTGATAGAAGCGGCGA
 
. : . : . : . : . : . :
rJMFF006O04+ GGATGGTATTCCTATGCTACTGAAGATTCCACGCCTATTTGATCCCTGGGGTGGTTATAG
rJMFF033P07+ GGATGGTATTCCTATGCTACTGAAGATTCCACGCNTATTTGATCCCTGGGGTGGTTATAG
rJMFF032J02+ GGATGGTATTCCTATGCTACTGAAGATTCCACGCCTATTTGATCCCTGGGGTGGTTATAG
                      ____________________________________________________________
consensus GGATGGTATTCCTATGCTACTGAAGATTCCACGCCTATTTGATCCCTGGGGTGGTTATAG
 
. : . : . : . : . : . :
rJMFF006O04+ CATCATAGGCTTTGGCGACATCCTTNTACCAGGACTGCTGGTTTCATTTTCACTGAGGTA
rJMFF033P07+ CATCATAGGCTTTGGNGACATCCTTCTACCAGGACTGNTGGTTTCATTTTCACTGAGGTA
rJMFF032J02+ CATCATAGGCTTTGGCGACATCCTTCTACCAGGACTGCTGGTTTCATTTTCACTGAGGTA
                      ____________________________________________________________
consensus CATCATAGGCTTTGGCGACATCCTTCTACCAGGACTGCTGGTTTCATTTTCACTGAGGTA
 
. : . : . : . : . : . :
rJMFF006O04+ TGATTGGCTTGCAAAGAAGAATCTCCGAGCTGGTTACTTTCTGTGGGCAATGCTTGCTTA
rJMFF033P07+ TGATTGGCTTGCAAAGAAGAATCTCCGAGCTGGTTACTTTCTGTGGGCAATGCTTGCTTA
rJMFF032J02+ TGATTGGCTTGCAAAGAAGAATCTCCGAGCTGGTTACTTTCTGTGGGCAATGCTTGCTTA
                      ____________________________________________________________
consensus TGATTGGCTTGCAAAGAAGAATCTCCGAGCTGGTTACTTTCTGTGGGCAATGCTTGCTTA
 
. : . : . : . : . : . :
rJMFF006O04+ TGGATTAGGCCTTCTCGTTACATATGTAGCGTTGAACCTTATGGATGGCCATGGCCAACC
rJMFF033P07+ TGGATTAGGCCTTCTCGTTACATATGTAGCGTTGAACCTTATGGATGGCCATGGCCAACC
rJMFF032J02+ TGGATTAGGCCTTCTCGTTACATATGTAGCGTTGAACCTTATGGATGGCCATGGCCAACC
                      ____________________________________________________________
consensus TGGATTAGGCCTTCTCGTTACATATGTAGCGTTGAACCTTATGGATGGCCATGGCCAACC
 
. : . : . : . : . : . :
rJMFF006O04+ CGCACTTCTTTACATCGTTCCATTTACCCTCGGGACGTTTCTGGCATTGGGTAGAAAGCG
rJMFF033P07+ CGCACTTCTTTACATCGTTCCATTTACCCTCGGGACGTTTCTGGCATTGGGTAGAAAGCG
rJMFF009N22+ GGCATTGGGTAGAAAGCG
rJMFF032J02+ CGCACTTCTTTACATCGTTCCATTTACCCTCGGGACGTTTCTGGCATTGGGTAGAAAGCG
                      ____________________________________________________________
consensus CGCACTTCTTTACATCGTTCCATTTACCCTCGGGACGTTTCTGGCATTGGGTAGAAAGCG
 
. : . : . : . : . : . :
rJMFF006O04+ AGGAGACCTTAAGATTCTGTGGACGAGGGGAGAACCGGAAAGGGTGTGCCCGCACATACG
rJMFF033P07+ AGGAGACCTTAAGATTCTGTGGACGAGGGGAGAACCGGAAAGGGTGTGCCCGCACATACG
rJMFF009N22+ AGGAGNCCTTAAGATTCTGTGGACGAGGGGAGAACCGGAAAGGGTGTGCCCGCACATACG
rJMFF032J02+ AGGAGACCTTAAGATTCTGTGGACGAGGGGAGAACCGGAAAGGGTGTGCCCGCACATACG
                      ____________________________________________________________
consensus AGGAGACCTTAAGATTCTGTGGACGAGGGGAGAACCGGAAAGGGTGTGCCCGCACATACG
 
. : . : . : . : . : . :
rJMFF006O04+ CCTCGAATCAACCCACGAATCGGATGAAGAAAAATGAAGTGTATAGCTCTTAATAATTAG
rJMFF033P07+ CCTCGAATCAACCCACGAATCGGATGAAGAAAAATGAAGTGTATAGCTCTTAATAATTAG
rJMFF009N22+ CCTCGAATCAACCCACGAATCGGATGAAGAAAAATGAAGTGTATAGCTCTTAATAATTAG
rJMFF032J02+ CCTCGAATCAACCCACGAATCGGATGAAGAAAAATGAAGTGTATAGCTCTTAATAATTAG
                      ____________________________________________________________
consensus CCTCGAATCAACCCACGAATCGGATGAAGAAAAATGAAGTGTATAGCTCTTAATAATTAG
 
. : . : . : . : . : . :
rJMFF006O04+ CTGNTAAAATGCATATGTTATTGCCACGAAGAAATGTTATGGTAAACAGGAACCAGCTGT
rJMFF033P07+ CTGCTAAAATGCATATGTTATTGCCACGAAGAAATGTTATGGTAAACAGGAACCAGCTGT
rJMFF009N22+ CTGCTAAAATGCATATGTTATTGCCACGAAGAAATGTTATGGTAAACAGGAACCAGCTGT
rJMFF032J02+ CTGCTAAAATGCATATGTTATTGCCACGAAGAAATGTTATGGTAAACAGGAACCAGCTGT
                      ____________________________________________________________
consensus CTGCTAAAATGCATATGTTATTGCCACGAAGAAATGTTATGGTAAACAGGAACCAGCTGT
 
. : . : . : . : . : . :
rJMFF006O04+ TTATTGTCTGGNTAAATCTGCAAATGATATGAACACTTATATTCAAGTTAA
rJMFF033P07+ TTATTGTCTGGCTAAATCTGCAAATGATATGAACACTTATATTCAAGTTAA
rJMFF009N22+ TTATTGTCTGGCTAAATCTGCAAATGATATGAACACTTATATTCAAGTTAA
rJMFF032J02+ TTATTGTCTGGCTAAATCTGCAAATGATATGAACACTTATATTCAAGTTAATGGACAATT
                      ____________________________________________________________
consensus TTATTGTCTGGCTAAATCTGCAAATGATATGAACACTTATATTCAAGTTAATGGACAATT