Previous Contig 009720:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032I07Sequence519009720 (2)gb:AC133333_17413154e-11Oryza sativa chromosome 3 BAC OJ1785_A05 genomic sequence, complete sequence.589009720 (2)gb:AC133333_17413156e-11Oryza sativa chromosome 3 BAC OJ1785_A05 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF032I07- AAGTTGTTCCCTCCTATATCTTTACAAGTGACAAGTCTTTAGGCTTTAT
rJMFF032I07+ AAGTTGTTCCCTCCTATATCTTTACAAGTGACAAGTCTTTAGGCTTTAT
                      ____________________________________________________________
consensus AAGTTGTTCCCTCCTATATCTTTACAAGTGACAAGTCTTTAGGCTTTAT
 
. : . : . : . : . : . :
JMFF032I07- AATTGTTGGAAAATAGTGTAGTGTAAAAATGGAAAATTTTGAGCTAATTGAGGGTGGAAA
rJMFF032I07+ AATTGTTGGAAAATAGTGTAGTGTAAAAATGGAAAATTTTGAGCTAATTGAGGGTGGAAA
                      ____________________________________________________________
consensus AATTGTTGGAAAATAGTGTAGTGTAAAAATGGAAAATTTTGAGCTAATTGAGGGTGGAAA
 
. : . : . : . : . : . :
JMFF032I07- TTCCCTTAATCGTCCCAAAGAGGGTCTTTCTAGCTTCCATGCTGGCAGAGATGATTACAA
rJMFF032I07+ TTCCCTTAATCGTCCCAAAGAGGGTCTTTCTAGCTTCCATGCTGGCAGAGATGATTACAA
                      ____________________________________________________________
consensus TTCCCTTAATCGTCCCAAAGAGGGTCTTTCTAGCTTCCATGCTGGCAGAGATGATTACAA
 
. : . : . : . : . : . :
JMFF032I07- GAAAGTGGGGGCTGATGAGAAGAAAGCAGCAGTTCATGAGGAAATGACGAGATTGAGCAG
rJMFF032I07+ GAAAGTGGGGGCTGATGAGAAGAAAGCAGCAGTTCATGAGGAAATGACGAGATTGAGCAG
                      ____________________________________________________________
consensus GAAAGTGGGGGCTGATGAGAAGAAAGCAGCAGTTCATGAGGAAATGACGAGATTGAGCAG
 
. : . : . : . : . : . :
JMFF032I07- ACTCCCTCAGAAGAGCGTATATGTATCTCATCGAACGCGGGTTTTGAATAAAATCCTCCA
rJMFF032I07+ ACTCCCTCAGAAGAGCGTATATGTATCTCATCGAACGCGGGTTTTGAATAAAATCCTCCA
                      ____________________________________________________________
consensus ACTCCCTCAGAAGAGCGTATATGTATCTCATCGAACGCGGGTTTTGAATAAAATCCTCCA
 
. : . : . : . : . : . :
JMFF032I07- ACTTTTGTCTATTCAGAGAACCACATCACAGGACGAGGAGTTGGAGTTGCTGTTTGCTGG
rJMFF032I07+ ACTTTTGTCTATTCAGAGAACCACATCACAGGACGAGGAGTTGGAGTTGCTGTTTGCTGG
                      ____________________________________________________________
consensus ACTTTTGTCTATTCAGAGAACCACATCACAGGACGAGGAGTTGGAGTTGCTGTTTGCTGG
 
. : . : . : . : . : . :
JMFF032I07- GCTCTCTCTTGGGTGATCAGAAGAAAATATCGAACCTCAAACGCAAGTTGAGAAGAGTGC
rJMFF032I07+ GCTCTCTCTTGGGTGATCAGAAGAAAATATCGAACCTCAAACGCAAGTTGAGAAGAGTGC
                      ____________________________________________________________
consensus GCTCTCTCTTGGGTGATCAGAAGAAAATATCGAACCTCAAACGCAAGTTGAGAAGAGTGC
 
. : . : . : . : . : . :
JMFF032I07- CTTACTGCATTGAAAGATGAGTAATATATGGTTGAATTGGTTCGCCAACATCAAATTCTC
rJMFF032I07+ CTTACTGCATTGAAAGATGAGTAATATATGGTTGAATTGGTTCGCCAACATCAAATTCTC
                      ____________________________________________________________
consensus CTTACTGCATTGAAAGATGAGTAATATATGGTTGAATTGGTTCGCCAACATCAAATTCTC
 
. : . : . : . : . : . :
JMFF032I07- ACCCATCACCGAGCTTGAGCGTCACTATATGAAAGTGATGTTGTTAACCG
rJMFF032I07+ ACCCATCACCGAGCTTGAGCGTCACTATATGAAAGTGATGTTGTTAACCGTGATGGTAGT
                      ____________________________________________________________
consensus ACCCATCACCGAGCTTGAGCGTCACTATATGAAAGTGATGTTGTTAACCGTGATGGTAGT
 
. : . : . : . : . : . :
rJMFF032I07+ TTCTGCTGGATGTGCTCAAACTGGTATCTGAAAGTTTGCACTGTTTTTGTATTGCAGTTA
                      ____________________________________________________________
consensus TTCTGCTGGATGTGCTCAAACTGGTATCTGAAAGTTTGCACTGTTTTTGTATTGCAGTTA