Previous Contig 009718:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032H19Sequence468003797 (6)gb:AY064040_15659781e-38Arabidopsis thaliana putative cellulose synthase catalytic subunit (At1g55850) m654009718 (2)gb:AP005759_18573772e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P055
JMSF002D14Sequence301003797 (6)gb:AY064040_15659782e-14Arabidopsis thaliana putative cellulose synthase catalytic subunit (At1g55850) m753009718 (2)gb:AP005759_18573774e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P055

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF002D14+ ATTT
                      ____________________________________________________________
consensus ATTT
 
. : . : . : . : . : . :
rJMSF002D14+ AGAAAAATAAAATTGGCTGCTCAAATGGGATACTGCATTTACCTCCTCTGGGCTCCAATC
                      ____________________________________________________________
consensus AGAAAAATAAAATTGGCTGCTCAAATGGGATACTGCATTTACCTCCTCTGGGCTCCAATC
 
. : . : . : . : . : . :
rJMSF002D14+ TCCATTCCTACACTCTGTTATGTCATTCTCCCTTCCCTTTGCTTGCTTCATAACATCTCC
                      ____________________________________________________________
consensus TCCATTCCTACACTCTGTTATGTCATTCTCCCTTCCCTTTGCTTGCTTCATAACATCTCC
 
. : . : . : . : . : . :
rJMSF002D14+ TTATTTCCAAAGGTAACCAGCATTTGGTTCCTGCCTTTTGCATACGTTTATGCAGCCAGG
rJMFF032H19+ CCAAAGGTAACCAGCATTTGGTTCCTGCCTTTTGCATACGTTTATGCAGCCAGG
                      ____________________________________________________________
consensus TTATTTCCAAAGGTAACCAGCATTTGGTTCCTGCCTTTTGCATACGTTTATGCAGCCAGG
 
. : . : . : . : . : . :
rJMSF002D14+ AATGGGTATGGATTAGCAGAAGCGTTGAGTAGCGGGGAGACAGTGAGGTCATGGTGGAAC
rJMFF032H19+ AATGGGTATGGATTAGCAGAAGCGTTGAGTAGCGGGGAGACAGTGAGGTCATGGTGGAAC
                      ____________________________________________________________
consensus AATGGGTATGGATTAGCAGAAGCGTTGAGTAGCGGGGAGACAGTGAGGTCATGGTGGAAC
 
. : . : . : . : . : . :
rJMSF002D14+ CTGCAAAGAATATGGATGATTCGGAGGACGACAACATACTTCTTTGCATTCTTTGATACA
rJMFF032H19+ CTGCAAAGAATATGGATGATTCGGAGGACGACAACATACTTCTTTGCATTCTTTGATACA
                      ____________________________________________________________
consensus CTGCAAAGAATATGGATGATTCGGAGGACGACAACATACTTCTTTGCATTCTTTGATACA
 
. : . : . : . : . : . :
rJMSF002D14+ GTTAGCAGACAATTAGGATTCACAGAAACTGCATTATTCACTCTCACAGGTAAGGTAATG
rJMFF032H19+ GTTAGCAGACAATTAGGATTCACAGAAACTGCATTATTCACTCTCACAGGTAAGGTAATG
                      ____________________________________________________________
consensus GTTAGCAGACAATTAGGATTCACAGAAACTGCATTATTCACTCTCACAGGTAAGGTAATG
 
. : . : . : . : . : . :
rJMSF002D14+ GACAACGATGTTGAGAAGAGATACCAACAGGAAATCATGGAATTCGGGAGCTCATCCCTC
rJMFF032H19+ GACAACGATGTTGAGAAGAGATACCAACAGGAAATCATGGAATTCGGGAGCTCATCCCTC
                      ____________________________________________________________
consensus GACAACGATGTTGAGAAGAGATACCAACAGGAAATCATGGAATTCGGGAGCTCATCCCTC
 
. : . : . : . : . : . :
rJMSF002D14+ ATGTTCACCATTACATCCATGCTAGCATTGCTGAACCTGTTGAGTTTCATCTGGGGAGCC
rJMFF032H19+ ATGTTCACCATTACATCCATGCTAGCATTGCTGAACCTGTTGGGTTTCATCTGGGGAGCC
                      ____________________________________________________________
consensus ATGTTCACCATTACATCCATGCTAGCATTGCTGAACCTGTTGGGTTTCATCTGGGGAGCC
 
. : . : . : . : . : . :
rJMSF002D14+ ATGAAACTGGGCTTGGCCCCGGAATTCCTCCCACAGGTGAGTCTGAGTGGGGTGATAGTG
rJMFF032H19+ ATGAAACTGGGCTTGGCCCCGGAATTCCTCCCACAGGTGAGTCTGAGTGGGGTGATAGTG
                      ____________________________________________________________
consensus ATGAAACTGGGCTTGGCCCCGGAATTCCTCCCACAGGTGAGTCTGAGTGGGGTGATAGTG
 
. : . : . : . : . : . :
rJMSF002D14+ ATGGTGAATATGCCTGTTTATGAAGCTCTTTTCATTCGGAAAGACAGCGGAAGCTTGCCA
rJMFF032H19+ ATGGTGAATATGCCTGTTTATGAAGCTCTTTTCATTCGGAAAGACAGCGGAAGCTTGCCA
                      ____________________________________________________________
consensus ATGGTGAATATGCCTGTTTATGAAGCTCTTTTCATTCGGAAAGACAGCGGAAGCTTGCCA
 
. : . : . : . : . : . :
rJMSF002D14+ TTATCGGTTCTTATAAGGTCTGTGCTCGCGCTATCTGTTGTTTGTTTGATGCCTGTCTTC
rJMFF032H19+ TTATCGGTTCTTATAAGGTCTGTGCTCGCGCTATCTGTTGTTTGTTTGATGCCTGTCTTC
                      ____________________________________________________________
consensus TTATCGGTTCTTATAAGGTCTGTGCTCGCGCTATCTGTTGTTTGTTTGATGCCTGTCTTC
 
. : . : . : . : . : . :
rJMSF002D14+ TTCCCAGGCAACGCAAAATGAATTGTAAGACTGTTTCCTTGAATTTCAACTGTCGAATTG
rJMFF032H19+ TTCCCAGGCAACGCAAAATGAATTGTAAGACTGTTTCCTTGAATTTCAACTGTCGAATTG
                      ____________________________________________________________
consensus TTCCCAGGCAACGCAAAATGAATTGTAAGACTGTTTCCTTGAATTTCAACTGTCGAATTG
 
. : . : . : . : . : . :
rJMSF002D14+ TAGTATTCGAAAGC-TGAAAAAACACAAAT
rJMFF032H19+ TAGTATTCGAAAGCTTGAAAAAACACAAATTGCTTTCTAATTGTTTCCCAAGTCTCTACC
                      ____________________________________________________________
consensus TAGTATTCGAAAGCTTGAAAAAACACAAATTGCTTTCTAATTGTTTCCCAAGTCTCTACC