Previous Contig 009713:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032G07Sequence514009713 (2)gb:AB019230_15141522e-59Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MEB5.686009713 (2)gb:AB019230_15141522e-45Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MEB5.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF032G07- GGGCATCAACGCAGAACGTCATCGATT
                      ____________________________________________________________
consensus GGGCATCAACGCAGAACGTCATCGATT
 
. : . : . : . : . : . :
JMFF032G07- CTGTAATGGAAGAAATCTTAGGAATTCTCAAAGTTCATATCAAACGAGGTGTCAACCTCG
                      ____________________________________________________________
consensus CTGTAATGGAAGAAATCTTAGGAATTCTCAAAGTTCATATCAAACGAGGTGTCAACCTCG
 
. : . : . : . : . : . :
JMFF032G07- CCGTTCGCGATATGAGGAGCAGCGATCCCTACATTGTTGTCAAGATGGATCAACAGAAGA
rJMFF032G07+ TGTTGTCAAGATGGATCANCAGAAGA
                      ____________________________________________________________
consensus CCGTTCGCGATATGAGGAGCAGCGATCCCTACATTGTTGTCAAGATGGATCAACAGAAGA
 
. : . : . : . : . : . :
JMFF032G07- TGAAGACTCGTATTGTACAGAAGGACGTCAACCCTGAATGGAATGAAGATCTTACCCTTA
rJMFF032G07+ TGAAGACTCGTATTGTACAGAAGGACGTCAACCCTGAATGGAATGAAGATCTTACCCTTA
                      ____________________________________________________________
consensus TGAAGACTCGTATTGTACAGAAGGACGTCAACCCTGAATGGAATGAAGATCTTACCCTTA
 
. : . : . : . : . : . :
JMFF032G07- CTGTCACAGATCCTAACACTCCCATTACGCTGACGGTGTACGATCACGACACATTCACGA
rJMFF032G07+ CTGTCACAGATCCTAACACTCCCATTACGCTGACGGTGTACGATCACGACACATTCACGA
                      ____________________________________________________________
consensus CTGTCACAGATCCTAACACTCCCATTACGCTGACGGTGTACGATCACGACACATTCACGA
 
. : . : . : . : . : . :
JMFF032G07- TGGACGACCTAATGGGAGACGCAGAGTTCGACATTAAGCCATTTCTAGACGCCCTGCAGA
rJMFF032G07+ TGGACGACCTAATGGGAGACGCAGAGTTCGACATTAAGCCATTTCTAGACGCCCTGCAGA
                      ____________________________________________________________
consensus TGGACGACCTAATGGGAGACGCAGAGTTCGACATTAAGCCATTTCTAGACGCCCTGCAGA
 
. : . : . : . : . : . :
JMFF032G07- TGAATTTAGATGGGTACCCGAGTGGCACCGTGATCACACGAATACTACCGTGCAGGGCTA
rJMFF032G07+ TGAATTTAGATGGGTACCCGAGTGGCACCGTGATCACACGAATACTACCGTGCAGGGCTA
                      ____________________________________________________________
consensus TGAATTTAGATGGGTACCCGAGTGGCACCGTGATCACACGAATACTACCGTGCAGGGCTA
 
. : . : . : . : . : . :
JMFF032G07- ACTGCCTGGCCGAGGAGTCGTGTGTGGTCTGGAAAGACGGCATGGTCTCGCAAGATATGT
rJMFF032G07+ ACTGCCTGGCCGAGGAGTCGTGTGTGGTCTGGAAAGACGGCATGGTCTCGCAAGATATGT
                      ____________________________________________________________
consensus ACTGCCTGGCCGAGGAGTCGTGTGTGGTCTGGAAAGACGGCATGGTCTCGCAAGATATGT
 
. : . : . : . : . : . :
JMFF032G07- CCTGCGATTGAGAAACGTAGAGTGCGGCGAGGTGGAGCTCCAACTTCAGTGGATTAACCT
rJMFF032G07+ CCTGCGATTGAGAAACGTAGAGTGCGGCGAGGTGGAGCTCCAACTTCAGTGGATTAACCT
                      ____________________________________________________________
consensus CCTGCGATTGAGAAACGTAGAGTGCGGCGAGGTGGAGCTCCAACTTCAGTGGATTAACCT
 
. : . : . : . : . : . :
JMFF032G07- CCCTGGC
rJMFF032G07+ CCCTGGCCAGTTAGGTTGAAAACTTGAAACTTGAAAGAGAGCAGCACCCACCACTCTCTC
                      ____________________________________________________________
consensus CCCTGGCCAGTTAGGTTGAAAACTTGAAACTTGAAAGAGAGCAGCACCCACCACTCTCTC
 
. : . : . : . : . : . :
rJMFF032G07+ TTCTTCTTCAAATCTCTACTGCTGTTCTGTTAAGCATTTGGTTCATAGCCCCAATGTCAC
                      ____________________________________________________________
consensus TTCTTCTTCAAATCTCTACTGCTGTTCTGTTAAGCATTTGGTTCATAGCCCCAATGTCAC
 
. : . : . : . : . : . :
rJMFF032G07+ ATAAAATGGACCTCTATGACCATTTATGTAAGTTATGTATCTTAACATGCATATATCATA
                      ____________________________________________________________
consensus ATAAAATGGACCTCTATGACCATTTATGTAAGTTATGTATCTTAACATGCATATATCATA
 
. : . : . : . : . : . :
rJMFF032G07+ TATGGGCCCTCAAATATTTCATTTATTATTATTTTTCTTTTTTAAATTTTCATGAGATAA
                      ____________________________________________________________
consensus TATGGGCCCTCAAATATTTCATTTATTATTATTTTTCTTTTTTAAATTTTCATGAGATAA
 
. : . : . : . : . : . :
rJMFF032G07+ ATGTACTCAAAATCTTCTTCTTCTTTGTAATAATAATAAGATTGTAATTTTACATAAGAA
                      ____________________________________________________________
consensus ATGTACTCAAAATCTTCTTCTTCTTTGTAATAATAATAAGATTGTAATTTTACATAAGAA