Previous Contig 009712:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032G03Sequence553009712 (8)gb:AF085279_17671644e-74Arabidopsis thaliana ABA-regulated gene cluster, complete sequence.742009712 (8)gb:AY085202_15702812e-52Arabidopsis thaliana clone 13800 mRNA, complete sequence.
JMFS129D04Sequence601009712 (8)gb:AF085279_17671641e-73Arabidopsis thaliana ABA-regulated gene cluster, complete sequence.
JMSF009M19Sequence315009712 (8)gb:AF085279_17671644e-32Arabidopsis thaliana ABA-regulated gene cluster, complete sequence.745009712 (8)gb:AY085202_15702819e-56Arabidopsis thaliana clone 13800 mRNA, complete sequence.
JMSF030O16Sequence640019647gb:AY035135_15599051e-39Arabidopsis thaliana unknown protein (At4g25370) mRNA, complete cds.>gb:AY059070733009712 (8)gb:AY085202_15702818e-65Arabidopsis thaliana clone 13800 mRNA, complete sequence.
JMSF031B04Sequence627009712 (8)gb:AC007020_15350334e-82Arabidopsis thaliana chromosome 2 clone T3G21 map g4514, complete sequence.>gb:A630009712 (8)gb:AY085202_15702811e-50Arabidopsis thaliana clone 13800 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS129D04- TCTCCTCACTTCTCCTCGGTCATCTCGAAACCCCCCAACACAGAAACCCTA
                      ____________________________________________________________
consensus TCTCCTCACTTCTCCTCGGTCATCTCGAAACCCCCCAACACAGAAACCCTA
 
. : . : . : . : . : . :
JMFS129D04- GCGCACTCTGACTCACAATCCAAGCCATGGCGACGGGCGGTCCGAACTTAGAGTGCCGGA
JMFF032G03- TCCGAACTTAGAGTGCCGGA
JMSF009M19- TCCGAACTTAGAGTGCCGGA
JMSF031B04- TCCGAACTTAGAGTGCCGGA
                      ____________________________________________________________
consensus GCGCACTCTGACTCACAATCCAAGCCATGGCGACGGGCGGTCCGAACTTAGAGTGCCGGA
 
. : . : . : . : . : . :
JMFS129D04- TGTACGAAGCCAAGTACCCGGAAGTGGACCAAGCCGTGATGATACAGGTTAAGAGCATGG
JMFF032G03- TGTACGAGGCTAAGTACCCCGAAGTGGACCACGCGGTGATGATACAGGTGAAAAGTATGG
JMSF009M19- TGTACGAGGCTAAGTACCCCGAAGTGGACCACGCGGTGATGATACAGGTGAAAAGTATGG
JMSF031B04- TGTACGAGGCTAAGTACCCCGAAGTGGACCACGCGGTGATGATACAGGTGAAAAGTATGG
                      ____________________________________________________________
consensus TGTACGAGGCTAAGTACCCCGAAGTGGACCACGCGGTGATGATACAGGTGAAAAGTATGG
 
. : . : . : . : . : . :
JMFS129D04- CCGACAGCGGCGCGTACGTCTCACTCCTGGAATACAACAACATCGAGGGAATGATCCTCT
JMFF032G03- CTGACAGCGGCGCCTATGTTTCGCTCCTCGAGTACAACAATATCGAGGGGATGATTCTCT
JMSF009M19- CTGACAGCGGCGCCTATGTTTCGCTCCTCGAGTACAACAATATCGAGGGGATGATTCTCT
JMSF031B04- CTGACAGCGGCGCCTATGTTTCGCTCCTCGAGTACAACAATATCGAGGGGATGATTCTCT
                      ____________________________________________________________
consensus CTGACAGCGGCGCCTATGTTTCGCTCCTCGAGTACAACAATATCGAGGGGATGATTCTCT
 
. : . : . : . : . : . :
JMFS129D04- TCTCCGAGCTCTCTCGCCGCCGGATACGGAGCATCAGCAGCTTAATCAAGGTCGGCCGGA
JMFF032G03- TCTCCGAGCTCTCTCGCCGCCGGATTCGTAGCATCAGTAGCTTAATCAAGGTGGGCCGAA
JMSF009M19- TCTCCGAGCTCTCTCGCCGCCGGATTCGTAGCATCAGTAGCTTAATCAAGGTGGGCCGAA
JMSF031B04- TCTCCGAGCTCTCTCGCCGCCGGATTCGTAGCATCAGTAGCTTAATCAAGGTGGGCCGAA
                      ____________________________________________________________
consensus TCTCCGAGCTCTCTCGCCGCCGGATTCGTAGCATCAGTAGCTTAATCAAGGTGGGCCGAA
 
. : . : . : . : . : . :
JMFS129D04- TCGAGCCCGTCATGGTCCTTCGTGTCGACAAGGAGAAGGGGTACATCGATCTCAGCAAGC
JMFF032G03- TCGAACCCGTTATGGTCCTTCGGGTTGACAAGGAGAAGGGTTACATCGATCTCAGCAAAC
JMSF009M19- TCGAACCCGTTATGGTCCTTCGGGTTGACAAGGAGAAGGGTTACATCGATCTCAGCAA
JMSF031B04- TCGAACCCGTTATGGTCCTTCGGGTTGACAAGGAGAAGGGTTACATCGATCTCAGCAAAC
                      ____________________________________________________________
consensus TCGAACCCGTTATGGTCCTTCGGGTTGACAAGGAGAAGGGTTACATCGATCTCAGCAAAC
 
. : . : . : . : . : . :
JMFS129D04- GGAGAGTCTCCGAGGAGGACATTCAGGCCTGTGAAGAGAGGTACAACAAGAGCAAGCTCG
JMFF032G03- GCCGGGTCTCCGAGGAGGATATTCAGGCTTGTGAAGAGAGGTATAATAAGAGCAAGCTTG
JMSF031B04- GCCGGGTCTCCGAGGAGGATATTCAGGCTTGTGAAGAGAGGTATAATAAGAGCAAGCTTG
                      ____________________________________________________________
consensus GCCGGGTCTCCGAGGAGGATATTCAGGCTTGTGAAGAGAGGTATAATAAGAGCAAGCTTG
 
. : . : . : . : . : . :
JMFS129D04- TCCATTCTATCATGCGCCACGTTGCCGAGACCATGAATATCGATCTCGAGGATCTTTACA
JMFF032G03- TTCACTCCATTATGCGCCATGTCGCGGAAACCATGCAAGTCGATCTCGAGGATCTTTACA
JMSF031B04- TTCACTCCATTATGCGCCATGTCGCGGAAACCATGCAAGTCGATCTCGAGGATCTTTACA
                      ____________________________________________________________
consensus TTCACTCCATTATGCGCCATGTCGCGGAAACCATGCAAGTCGATCTCGAGGATCTTTACA
 
. : . : . : . : . : . :
JMFS129D04- TTCATGTTGGTTGGCCTCTATACAGAAAATATGGACATGCTTTTGAGGCATTCAAACTAG
JMFF032G03- TCCATGTTGGTTGGCCTTTATATAGAAAATATGGTCATGCTTTTGAGGCTTTCAAGTTGG
JMSF031B04- TCCATGTTGGTTGGCCTTTATATAGAAAATATGGTCATGCTTTTGAGGCTTTCAAGTTGG
                      ____________________________________________________________
consensus TCCATGTTGGTTGGCCTTTATATAGAAAATATGGTCATGCTTTTGAGGCTTTCAAGTTGG
 
. : . : . : . : . : . :
JMFS129D04- TTGTTAATGATCCAGATTCTGTTCTTAATTCCCTCACTCGTGAAGTTAAAGAAGTTGGTC
JMFF032G03- TTGTTAATGATCCAGATTCTGTTCTAAATTCCCTCACCCGTGAAGTTAAAGATGTTGGCC
JMSF031B04- TTGTTAATGATCCAGATTCTGTTCTAAATTCCCTCACCCGTGAAGTTAAAGATGTTGGCC
rJMSF030O16+ AATTCCCTCACTCGTGAAGTTAAAGAAGTTGGTC
rJMSF009M19+ TTAAAGATGTTGGCC
                      ____________________________________________________________
consensus TTGTTAATGATCCAGATTCTGTTCTAAATTCCCTCACTCGTGAAGTTAAAGATGTTGGCC
 
. : . : . : . : . : . :
JMFS129D04- CTGATGG
JMFF032G03- CTGATGG
JMSF031B04- CTGATGGGAAGGAGGTAACT-AAGGTGGTTCCCGCACTATCAGAGGAAGTTAAAGATTCT
rJMSF030O16+ CTGATGGTCAGGAGGTAACTAAA-GTGGTTCCTGCACTAACAGAAGATGTTAAAGATTCT
rJMSF009M19+ CTGATNGGAAGGAGGTAACTAAAGGTGGTTCCCGCACTATCAGAGGAAGTTAAAGATTCT
rJMSF031B04+ GTTAAAGATTCT
rJMFF032G03+ GTTAAAGATTCT
                      ____________________________________________________________
consensus CTGATGGGAAGGAGGTAACTAAAGGTGGTTCCCGCACTATCAGAGGAAGTTAAAGATTCT
 
. : . : . : . : . : . :
JMSF031B04- TTGG
rJMSF030O16+ TTGGTAAAAAATATTAGGAGAAGAATGACCCCACAGCCTTTGAAGATTCGCGCAGATATT
rJMSF009M19+ TTGGTAAAAAATATTAGGAGAAGAATGACACCACAACCACTGAAGATTCGGGCTGATATT
rJMSF031B04+ TNGGTAAAAAATATTAGGAGAAGAATGACACCACANCCACTGAAGATTCGGGCTGATATT
rJMFF032G03+ TTGGTAAAAAATATTAGGAGAAGAATGACACCACAACCACTGAAGATTCGGGCTGATATT
                      ____________________________________________________________
consensus TTGGTAAAAAATATTAGGAGAAGAATGACACCACAACCACTGAAGATTCGGGCTGATATT
 
. : . : . : . : . : . :
rJMSF030O16+ GAGATGAAATGTTTTCAGTTTGATGGTGTTCTTCACATTAAGGATGCAATGCGGAAAGCT
rJMSF009M19+ GAGATGAAATGTTTTCAATTTGATGGTGTTCTTCACATTAAGGATGCAATGCGTAAAGCT
rJMSF031B04+ GAGATGAAATGTTTTCAATTTGATGGTGTTCTTCACATTAAGGATGCAATGCGTAAAGCT
rJMFF032G03+ GAGATGAAATGTTTTCAATTTGATGGTGTTCTTCACATTAAGGATGCAATGCGTAAAGCT
                      ____________________________________________________________
consensus GAGATGAAATGTTTTCAATTTGATGGTGTTCTTCACATTAAGGATGCAATGCGTAAAGCT
 
. : . : . : . : . : . :
rJMSF030O16+ GAAGCTTCTGGTAATAAGGATTGCCCAGTTAAAATTAAACTTGTTGCTCCTCCAGCATAT
rJMSF009M19+ GAAGCTGCTGGTAATATCGATTGCCCTGTTAAAATTAAACTTGTCGCCCCTCCAGCATAT
rJMSF031B04+ GAAGCTGCTGGTAATATCGATTGCCCTGTTAAAATTAAACTTGTCGCCCCTCCAGCATAT
rJMFF032G03+ GAAGCTGCTGGTAATATCGATTGCCCTGTTAAAATTAAACTTGTCGCCCCTCCAGCATAT
                      ____________________________________________________________
consensus GAAGCTGCTGGTAATATCGATTGCCCTGTTAAAATTAAACTTGTCGCCCCTCCAGCATAT
 
. : . : . : . : . : . :
rJMSF030O16+ GTTCTTAACACTCAGACGCTTGATAAGGAGCAAGGCATTGCAATCCTTGACAAAGCAATT
rJMSF009M19+ GTTCTCAACACTCAGACTCTTGACAAGGAGCAAGGCATAACTGTCCTTAATCAAGCAATT
rJMSF031B04+ GTTCTCAACACTCAGACTCTTGACAAGGAGCAAGGCATAACTGTCCTTAATCAAGCAATT
rJMFF032G03+ GTTCTCAACACTCAGACTCTTGACAAGGAGCAAGGCATAACTGTCCTTAATCAAGCAATT
                      ____________________________________________________________
consensus GTTCTCAACACTCAGACTCTTGACAAGGAGCAAGGCATAACTGTCCTTAATCAAGCAATT
 
. : . : . : . : . : . :
rJMSF030O16+ GCTGCTTGCACCGAGGAAATAGAACGTCACAAGGGAAAACTCACTGTCAAGGAAGCGCCA
rJMSF009M19+ GCAGCTTGCACTGAGGAAATTGAGCGTCATAAGGGAAAACTCACTGTGAAGGAGGCTCCT
rJMSF031B04+ GCAGCTTGCACTGAGGAAATTGAGCGTCATAAGGGAAAACTCACTGTGAAGGAGGCTCCT
rJMFF032G03+ GCAGCTTGCACTGAGGAAATTGAGCGTCATAAGGGAAAACTCACTGTGAAGGAGGCTCCT
                      ____________________________________________________________
consensus GCAGCTTGCACTGAGGAAATTGAGCGTCATAAGGGAAAACTCACTGTGAAGGAGGCTCCT
 
. : . : . : . : . : . :
rJMSF030O16+ AGAGCGGTGAGTGAAAGAGAGGATAAATTACTTGCTGAGCAAATGGCTAAGCTAGGACAA
rJMSF009M19+ AGAGCGGTGAGTGAAAGGGAGGATAAACTCCTTGCTGAACAGATGGCTAAGCTAACCCGT
rJMSF031B04+ AGAGCGGTGAGTGAAAGGGAGGATAAACTCCTTGCTGAACAGATGGCTAAGCTAACCCGT
rJMFF032G03+ AGAGCGGTGAGTGAAAGGGAGGATAAACTCCTTGCTGAACAGATGGCTAAGCTAACCCGT
                      ____________________________________________________________
consensus AGAGCGGTGAGTGAAAGGGAGGATAAACTCCTTGCTGAACAGATGGCTAAGCTAACCCGT
 
. : . : . : . : . : . :
rJMSF030O16+ GCGAACGAGGAGGTCAGCGGTGATGAAGATAGCGAAGAGGAGGAAGATACGGGTATGGGA
rJMSF009M19+ GAGAATGAGGAGGTCAGCGGTGATGAAGATAGTGAGGAGGAAGAAGATACGGGGATGGGA
rJMSF031B04+ GAGAATGAGGAGGTCAGCGGTGATGAAGATAGTGAGGAGGAAGAAGATACGGGGATGGGA
rJMFF032G03+ GAGAATGAGGAGGTCAGCGGTGATGAAGATAGTGAGGAGGAAGAAGATACGGGGATGGGA
                      ____________________________________________________________
consensus GAGAATGAGGAGGTCAGCGGTGATGAAGATAGTGAGGAGGAAGAAGATACGGGGATGGGA
 
. : . : . : . : . : . :
rJMSF030O16+ GAAATTGATGTAGAAAACACGGGACATGGTATAACAGAGTGAA
rJMSF009M19+ GAAATTGATGTGGAGAACTCAGGACATGGCATAACAGAATGAATACTCCGTTTAATCCCC
rJMSF031B04+ GAAATTGATGTGGAGAACTCAGGACATGGCATAACAGAATGAA
rJMFF032G03+ GAAATTGATGTGGAGAACTCAGGACATGGCATAACAGAATGAATACTCCGTTTAATCCCC
                      ____________________________________________________________
consensus GAAATTGATGTGGAGAACTCAGGACATGGCATAACAGAATGAATACTCCGTTTAATCCCC
 
. : . : . : . : . : . :
rJMSF009M19+ AACTCAGAAGATACACTTCCAATATTGATGCAGCACTCTCCATACTACTGGGTGGATGTA
rJMFF032G03+ AACTCAGAAGATACACTTCCAATATTGATGCAGCACTCTCCATACTACTGGGTGGATGTA
                      ____________________________________________________________
consensus AACTCAGAAGATACACTTCCAATATTGATGCAGCACTCTCCATACTACTGGGTGGATGTA
 
. : . : . : . : . : . :
rJMSF009M19+ TACAATTTTGAATTTTGTCAAGCATTTTTTTTCTTTTTATAATTACCTGTTTCATGTATT
rJMFF032G03+ TACAATTTTGAATTTTGTCAAGCATTTTTTTTCTTTTTATAATTACCTGTTTCATGTATT
                      ____________________________________________________________
consensus TACAATTTTGAATTTTGTCAAGCATTTTTTTTCTTTTTATAATTACCTGTTTCATGTATT
 
. : . : . : . : . : . :
rJMSF009M19+ CATTTAGCAGTTTTACAATGTCTTGCTGACAAGTAGCACATTCTGGAGCTGTTTATCTGC
rJMFF032G03+ CATTTAGCAGTTTTACAATGTCTTGCTGACAAGTAGCACATTCTGGAGCTGTTTATCTGC
                      ____________________________________________________________
consensus CATTTAGCAGTTTTACAATGTCTTGCTGACAAGTAGCACATTCTGGAGCTGTTTATCTGC
 
. : . : . : . : . : . :
rJMSF009M19+ ACATATGTTG
rJMFF032G03+ ACATATGTTGTGCATTTCTGCATTCTATTGTGTCCAGATGCCGCAGCTTTGCATCATCAT
                      ____________________________________________________________
consensus ACATATGTTGTGCATTTCTGCATTCTATTGTGTCCAGATGCCGCAGCTTTGCATCATCAT