Previous Contig 009711:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032F23Sequence609001460 (10)gb:AY457044_16072311e-16Arabidopsis thaliana TATA-binding protein associated factor 4b (TAF4B) mRNA, par776009711 (4)gb:OSA307662_16924806e-24Oryza sativa genomic DNA fragment, chromosome 2.
JMSF026N17Sequence288001460 (10)gb:AY457044_16072314e-11Arabidopsis thaliana TATA-binding protein associated factor 4b (TAF4B) mRNA, par658009711 (4)gb:AP004676_18431921e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMSF049I06Sequence721009711 (4)gb:OSA307662_16924802e-29Oryza sativa genomic DNA fragment, chromosome 2.
JMSF051F03Sequence698001460 (10)gb:AY457044_16072311e-19Arabidopsis thaliana TATA-binding protein associated factor 4b (TAF4B) mRNA, par776009711 (4)gb:OSA307662_16924808e-29Oryza sativa genomic DNA fragment, chromosome 2.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF049I06+ CAA
                      ____________________________________________________________
consensus CAA
 
. : . : . : . : . : . :
rJMSF049I06+ GACATAGAACAATTGNTCACCTCTGATGTTCGCCAACAAATCATGGCAATGAACCGAAAG
rJMSF051F03+ CGCCNACAAATCANGGCAATGAACCGAAAG
                      ____________________________________________________________
consensus GACATAGAACAATTGNTCACCTCTGATGTTCGCCAACAAATCATGGCAATGAACCGAAAG
 
. : . : . : . : . : . :
rJMSF049I06+ GCTCGGGAAGAATGGGAAAGGAAGCAATCTGAAGCAGAAAAAGTCCAAAAGACAAATGAA
rJMSF051F03+ GCTCGGGAAGAATGGGAAAGGAAGCCATTTGAAGCAGAAAAAGTCCAAAAGACAAATGAN
rJMSF026N17+ CAAATGAT
rJMFF032F23+ GGGAAGAATGGGAAAGGAAGCAATCTGAAGCAGAAAAAGTCCAAAAGACAAATGAA
                      ____________________________________________________________
consensus GCTCGGGAAGAATGGGAAAGGAAGCAATCTGAAGCAGAAAAAGTCCAAAAGACAAATGAA
 
. : . : . : . : . : . :
rJMSF049I06+ CCAGATGGCGATGCTGCAGCTGATGGTGATAAGGATAAGGATGACAGTCAGGCAAAATCA
rJMSF051F03+ CCAGATGGCGATGCTGCAGCTGATGGTGATAAGGATAAGGATGACAGTCAGGCAAAATCA
rJMSF026N17+ CCAGATGGCGATGCTGCAGCTGATGGTGATAAGGATAAGGATGACAGTCAGGCAAAATCA
rJMFF032F23+ CCAGATGGCGATGCTGCAGCTGATGGTGATAAGGATAAGGATGACAGTCAGGCAAAATCA
                      ____________________________________________________________
consensus CCAGATGGCGATGCTGCAGCTGATGGTGATAAGGATAAGGATGACAGTCAGGCAAAATCA
 
. : . : . : . : . : . :
rJMSF049I06+ GTGAAGGTAAACAAGGAAGAGGATGACAAGATGCGCACAACAGCTGCAAATGTTGCTGCT
rJMSF051F03+ GTGAAGGTAAACAAGGAAGAGGATGACAAGGTGCGCACAACAGCTGCAAATGTTGCTGCT
rJMSF026N17+ GTGAAGGTAAACAAGGAAGAGGATGACAAGATGCGCACAACAGCTGCAAATGTTGCTGCT
rJMFF032F23+ GTGAAGGTAAACAAGGAAGAGGATGACAAGATGCGCACAACAGCTGCAAATGTTGCTGCT
                      ____________________________________________________________
consensus GTGAAGGTAAACAAGGAAGAGGATGACAAGATGCGCACAACAGCTGCAAATGTTGCTGCT
 
. : . : . : . : . : . :
rJMSF049I06+ CGAGCTGCTGTTGGTGGAGATGACATGTTGTCAAAATGGCAGTTAATAGCAGAACAGGCT
rJMSF051F03+ CGAGCTGCTGTTGGTGGAGATGACATGTTGTCAAAATGGCAGTTAATGGCAGAACAGGCT
rJMSF026N17+ CGAGCTGCTGTTGGTGGAGATGACANGTTGTCAAAATGGCAGTTAATGGCAGAACAGGCT
rJMFF032F23+ CGAGCTGCTGTTGGTGGAGATGACATGTTGTCAAAATGGCAGTTAATGGCAGAACAGGCT
                      ____________________________________________________________
consensus CGAGCTGCTGTTGGTGGAGATGACATGTTGTCAAAATGGCAGTTAATGGCAGAACAGGCT
 
. : . : . : . : . : . :
rJMSF049I06+ AAGCAGAAACGTGATGCGGCATCGAGCTCACATCCTGGTAAAGATATGCCCCAGAGGGCA
rJMSF051F03+ AAGCAGAAACGTGATGCGGCATCGAGCTCACATCCTGGTAAAGATATGCCCCAGAGGGCA
rJMSF026N17+ AAGCAGAAACGTGATGCGGCATCGAGCTCACATCCTGGTAAAGATATGCCCCAGAGGGCA
rJMFF032F23+ AAGCAGAAACGTGATGCGGCATCGAGCTCACATCCTGGTAAAGATATGCCCCAGAGGGCA
                      ____________________________________________________________
consensus AAGCAGAAACGTGATGCGGCATCGAGCTCACATCCTGGTAAAGATATGCCCCAGAGGGCA
 
. : . : . : . : . : . :
rJMSF049I06+ TCGTCATCCTCCAGTAGAAATACAAGGGACAACCAAGAAGCTGAAAAAAGGAGTTCATCA
rJMSF051F03+ TCGTCATCCTCCAGTAGAAATACAAGGGACAACCAAGAAGCTGAAAAAAGGAGTTCATCA
rJMSF026N17+ TCGTCATCCTCCAGTAGAAATACAAGGGACAACCAAGAAGCTGAAAAAAGGAGTTCATCA
rJMFF032F23+ TCGTCATCCTCCAGTAGAAATACAAGGGACAACCAAGAAGCTGAAAAAAGGAGTTCATCA
                      ____________________________________________________________
consensus TCGTCATCCTCCAGTAGAAATACAAGGGACAACCAAGAAGCTGAAAAAAGGAGTTCATCA
 
. : . : . : . : . : . :
rJMSF049I06+ GCTGCCAGTATCACACCAGGTGATGATAGGAATGTTGGGAGAAATCAACTTGTGTCCCAA
rJMSF051F03+ GCTGCCAGTATCACACCAGGTGATGATAGGAATGTTGGGAGAAATCAACTTGTGTCCCAA
rJMSF026N17+ GCTGCCAGTATCACACCAGGTGATGATAGGAATGTTGGGAGAAATCAACTTGTGTCCCAA
rJMFF032F23+ GCTGCCAGTATCACACCAGGTGATGATAGGAATGTTGGGAGAAATCAACTTGTGTCCCAA
                      ____________________________________________________________
consensus GCTGCCAGTATCACACCAGGTGATGATAGGAATGTTGGGAGAAATCAACTTGTGTCCCAA
 
. : . : . : . : . : . :
rJMSF049I06+ GCTAGAGTTGGTTGCAGTATTACTATCAAAGACGTAATAGCTGTCCTTGAAAGGGAGCCA
rJMSF051F03+ GCTAGAGTTGGTTGCAGTATTACTATCAAAGACGTAATAGCTGTCCTTGAAAGGGAGCCA
rJMSF026N17+ GCTAGAGTTGGTTGCAGTATTACTATCAAAGACGTAATAGCTGTCCTTGAAAGGGAGCCA
rJMFF032F23+ GCTAGAGTTGGTTGCAGTATTACTATCAAAGACGTAATAGCTGTCCTTGAAAGGGAGCCA
                      ____________________________________________________________
consensus GCTAGAGTTGGTTGCAGTATTACTATCAAAGACGTAATAGCTGTCCTTGAAAGGGAGCCA
 
. : . : . : . : . : . :
rJMSF049I06+ CAAACATCCAAGTCTACATTAGTTTATCGTTTGTATGAGAGAATTTGTTCCGATGGTTTG
rJMSF051F03+ CAAACATCCAAGTCTACATTAGTTTATCGTTTGTATGAGAGAATTTGTTCCGATGGTTTG
rJMSF026N17+ CAAACATCCAAGTCTACATTAGTTTATCGTTTGTATGAGAGAATTTGTTCCGATGGTTTG
rJMFF032F23+ CAAACATCCAAGTCTACATTAGTTTATCGTTTGTATGAGAGAATTTGTTCCGATGGTTTG
                      ____________________________________________________________
consensus CAAACATCCAAGTCTACATTAGTTTATCGTTTGTATGAGAGAATTTGTTCCGATGGTTTG
 
. : . : . : . : . : . :
rJMSF049I06+ GCTGAATAGTTCCGGTGCCGTGTTTATGGAGTTCTTGTGCACCGTTAAGTGGCGAACAAA
rJMSF051F03+ GCTGAATAGTTCCGGTGCCGTGTTTATGGAGTTCTTGTGCACCGTTAAGTGGCGAACAAA
rJMSF026N17+ GCTGAATAGTTCCGGTGCCGTGTTTATGGAGTTCNTGTGCACCGTTAAGTGGCGAACAAA
rJMFF032F23+ GCTGAATAGTTCCGGTGCCGTGTTTATGGAGTTCTTGTGCACCGTTAAGTGGCGAACAAA
                      ____________________________________________________________
consensus GCTGAATAGTTCCGGTGCCGTGTTTATGGAGTTCTTGTGCACCGTTAAGTGGCGAACAAA
 
. : . : . : . : . : . :
rJMSF049I06+ TACATTTTCACGTTTTCCCCTCTTTGTTCCTTTTTCGTTTCTACCTATAGCATC
rJMSF051F03+ TACATTTTCACGTTTTCCCCTCTTTGTTCCTTTTTCGTTTCTACCTATAGCATCTTGTTA
rJMSF026N17+ TACATTTTCACGTTTTCCCCTCTTTGTTCCTTTTTCGTTTCTACCTATAGCATCNTGTTA
rJMFF032F23+ TACATTTTCACGTTTTCCCCTCTTTGTTCCTTTTTCGTTTCTACCTATAGCATCTTGTTA
                      ____________________________________________________________
consensus TACATTTTCACGTTTTCCCCTCTTTGTTCCTTTTTCGTTTCTACCTATAGCATCTTGTTA
 
. : . : . : . : . : . :
rJMSF051F03+ TTAGTTGATTATTATAGTCAGTTTGTTGAATAGAAGCTGTAAAAGGTGTACACTCATATT
rJMSF026N17+ TTAGTTGATTATTATAGTCAGTTTGTTGAATAGAAGCTGTAAAAGGTGTA
rJMFF032F23+ TTAGTTGATTATTATAGTCAGTTTGTTGAATAGAAGCTGTAAAAGGTGTACACTCATATT
                      ____________________________________________________________
consensus TTAGTTGATTATTATAGTCAGTTTGTTGAATAGAAGCTGTAAAAGGTGTACACTCATATT
 
. : . : . : . : . : . :
rJMSF051F03+ GCTTATATTTTTCAGCACTGTATCAC
rJMFF032F23+ GCTTATATTTTTCAGCACTGTATCACAAATTCACAAGAAAGCTCTGTAGTGCCTTCTTTT
                      ____________________________________________________________
consensus GCTTATATTTTTCAGCACTGTATCACAAATTCACAAGAAAGCTCTGTAGTGCCTTCTTTT