Previous Contig 009703:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010G22Sequence604001447 (4)pir|G96776|G967763e-19hypothetical protein F25A4.28 [imported] - Arabidopsis thaliana>gb:AE005173_8950717009703 (4)pir|G96776|G967762e-81hypothetical protein F25A4.28 [imported] - Arabidopsis thaliana>gb:AE005173_8950
JMFF032C14Sequence411001447 (4)pir|G96776|G967761e-05hypothetical protein F25A4.28 [imported] - Arabidopsis thaliana>gb:AE005173_8950648009703 (4)gb:BT005012_16379586e-60Arabidopsis thaliana clone U50601 unknown protein (At1g18900) mRNA, complete cds
JMFF039C03Sequence417001447 (4)pir|G96776|G967761e-06hypothetical protein F25A4.28 [imported] - Arabidopsis thaliana>gb:AE005173_8950705009703 (4)pir|G96776|G967761e-78hypothetical protein F25A4.28 [imported] - Arabidopsis thaliana>gb:AE005173_8950
JMFS062E05Sequence617009703 (4)pir|G96776|G967769e-76hypothetical protein F25A4.28 [imported] - Arabidopsis thaliana>gb:AE005173_8950

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS062E05- TAAAGATGGAGAT
                      ____________________________________________________________
consensus TAAAGATGGAGAT
 
. : . : . : . : . : . :
JMFS062E05- AAACCTTGCTTCTCAGCTGCTGCACAGAAGCTCAAACATCATCTGACCTGAAATTTTGTC
rJMFF039C03+ TGCACAGAAGCTCAAACATCATCTGACCTGAAATTTTGTC
rJMFF010G22+ CTTCTCAGCTGCTGCACAGAAGCTCAAACATCATCTGACCTGAAATTTTGTC
                      ____________________________________________________________
consensus AAACCTTGCTTCTCAGCTGCTGCACAGAAGCTCAAACATCATCTGACCTGAAATTTTGTC
 
. : . : . : . : . : . :
JMFS062E05- GTGAGCTTATGGAAATCACGGGCCACCCAGCTCACGCGTTCTTGAAGACGATGCCATCAG
rJMFF039C03+ GTNAGCTTATGGAAATCACGGGCCACCCAGCTCACGCGTTCTTGAAGACGATGCCATCAG
rJMFF010G22+ GTGAGCTTATGGAAATCACGGGCCACCCAGCTCACGCGTTCTTGAAGACGATGCCATCAG
                      ____________________________________________________________
consensus GTGAGCTTATGGAAATCACGGGCCACCCAGCTCACGCGTTCTTGAAGACGATGCCATCAG
 
. : . : . : . : . : . :
JMFS062E05- CGGGGCCTGACGGGCAGAATGTGAGGGATCAC-GTTAGCTGCTTCTTGGACTTAATGCGC
rJMFF039C03+ CGGGGCCTGACGGGCAGAATGTGAGGGATCAC-GTTAGCTGCTTCTTGGACTTAATGCGC
rJMFF010G22+ CGGGGCCTGACGGGCAGAATGTGAGGGATCAC-GTTAGCTGCTTCTTGGACTTAATGCGC
rJMFF032C14+ GGCAGAATGTGAGGGATCACGGTTAGCTGCTTCTTGGACTTAATGCGC
                      ____________________________________________________________
consensus CGGGGCCTGACGGGCAGAATGTGAGGGATCAC-GTTAGCTGCTTCTTGGACTTAATGCGC
 
. : . : . : . : . : . :
JMFS062E05- AGCGAGGACAGGGAGAGCAAGCGGGGGCTTATTGATGCGGTTGTCGATTTCCTCCACAAG
rJMFF039C03+ AGCGAGGACAGGGAGAGCAAGCGGGGGCTTATTGATGCGGTTGTCGATTTCCTCCACAAG
rJMFF010G22+ AGCGAGGACAGGGAGAGCAAGCGGGGGCTTATTGATGCGGTTGTCGATTTCCTCCACAAG
rJMFF032C14+ ANCGAGGACAGGGAGAGCAAGCGGGGGCTTATTGATGCGGTNGTCGATTTCCTCCACAAG
                      ____________________________________________________________
consensus AGCGAGGACAGGGAGAGCAAGCGGGGGCTTATTGATGCGGTTGTCGATTTCCTCCACAAG
 
. : . : . : . : . : . :
JMFS062E05- TCGGGGCTCAAGGAGGAAGCCGCATCCGTCTGGGAGGCGGCTGCAGAGAGGAACATCTAC
rJMFF039C03+ TCGGGGCTCAAGGAGGAAGCCGCATCCGTCTGGGAGGCGGCTGCAGAGAGGAACATCTAC
rJMFF010G22+ TCGGGGCTCAAGGAGGAAGCCGCATCCGTCTGGGAGGCGGCTGCAGAGAGGAACATCTAC
rJMFF032C14+ TCGGGGCTCAAGGAGGAAGCCGCATCCGTCTGGGAGGCGGCTGCAGAGAGGAACATCTAC
                      ____________________________________________________________
consensus TCGGGGCTCAAGGAGGAAGCCGCATCCGTCTGGGAGGCGGCTGCAGAGAGGAACATCTAC
 
. : . : . : . : . : . :
JMFS062E05- CCGGAGGCTGTACGAGAGAAAGGCTCCCGCTACTGGCTGATAAACCTTCACGTGATGTCT
rJMFF039C03+ CCGGAGGCTGTACGAGAGAAAGGCTCCCGCTACTGGCTGATAAACCTTCACGTGATGTCT
rJMFF010G22+ CCGGAGGCTGTACGAGAGAAAGGCTCCCGCTACTGGCTGATAAACCTTCACGTGATGTCT
rJMFF032C14+ CCGGAGGCTGTNCGAGAGAAAGGCTCCCGCTACTGGCTGATAAACCTTCACGTGATGTCT
                      ____________________________________________________________
consensus CCGGAGGCTGTACGAGAGAAAGGCTCCCGCTACTGGCTGATAAACCTTCACGTGATGTCT
 
. : . : . : . : . : . :
JMFS062E05- GATGGGACCGCTGTCACGGCTCTGTCGAGGACGCTAGCCTCGTTCCGCAAGCACATGCTT
rJMFF039C03+ GATGGGACCGCTGTCACGGCTCTGTCGAGGACGCTAGCCTCGTTCCGCAAGCACATGCTT
rJMFF010G22+ GATGGGACCGCTGTCACGGCTCTGTCGAGGACGCTAGCCTCGTTCCGCAAGCACATGCTT
rJMFF032C14+ GATGGGACCGCTGTCACGGCTCTGTCGAGGACGCTAGCCTCGTTCCGCAAGCACATGCTT
                      ____________________________________________________________
consensus GATGGGACCGCTGTCACGGCTCTGTCGAGGACGCTAGCCTCGTTCCGCAAGCACATGCTT
 
. : . : . : . : . : . :
JMFS062E05- TCGTCTGGAGTTTGCCCCAACCGGATCGATATCGTGACTGGGTGGGGCCGGAGGAGTCGG
rJMFF039C03+ TCGTCTGGAGTTTGCCCCAACCGGATCGATATCGTGACTGGGTGGGGCCGGAGGAGTCGG
rJMFF010G22+ TCGTCTGGAGTTTGCCCCAACCGGATCGATATCGTGACTGGGTGGGGCCGGAGGAGTCGG
rJMFF032C14+ TCGTCTGGAGTTTGCCCCAACCGGATCGATATCGTGACTGGGTGGGGCCGGAGGAGTCGG
                      ____________________________________________________________
consensus TCGTCTGGAGTTTGCCCCAACCGGATCGATATCGTGACTGGGTGGGGCCGGAGGAGTCGG
 
. : . : . : . : . : . :
JMFS062E05- GTGACAGGCACGTCTCTTGTGAGGCAAACCATACAGGAGGTGCTCAGCATGCTCAACTCC
rJMFF039C03+ GTGACAGGCACGTCTCTTGTGAGGCAAACCATACAGGAGGTGCTCAGCATGCTCAACTCC
rJMFF010G22+ GTGACAGGCACGTCTCTTGTGAGGCAAACCATACAGGAGGTGCTCAGCATGCTCAACTCC
rJMFF032C14+ GTGACAGGCACGTCTCTTGTGAGGCAAACCATACAGGAGGTGCTCAGCATGCTCAACTCC
                      ____________________________________________________________
consensus GTGACAGGCACGTCTCTTGTGAGGCAAACCATACAGGAGGTGCTCAGCATGCTCAACTCC
 
. : . : . : . : . : . :
JMFS062E05- CCCTTTCTTCCTGTTAATGGTAACTCTGGGTGTTTTGTAGGGCGTGGAGAATCTCTCAGT
rJMFF039C03+ CCCTTTCTTCCTGTTAATGGTAACTCTGGGTGTTTTGTAGGGCGTGGAGAATCTCTCAGT
rJMFF010G22+ CCCTTTCTTCCTGTTAATGGTAACTCTGGGTGTTTTGTAGGGCGTGGAGAATCTCTCAGT
rJMFF032C14+ CCCTTTCTTCCTGTTAATGGTAACTCTGGGTGTTTTGTAGGGCGTGGAGAATCTCTCAGT
                      ____________________________________________________________
consensus CCCTTTCTTCCTGTTAATGGTAACTCTGGGTGTTTTGTAGGGCGTGGAGAATCTCTCAGT
 
. : . : . : . : . : . :
JMFS062E05- AAATG
rJMFF039C03+ AAATGGTTGGTCCAACCTTACGTTGAACGGATGCATTTGCTGTAGTTATCATGTAAAGAT
rJMFF010G22+ AAATGGTTGGTCCAACCTTACGTTGAACGGATGCATTTGCTGTAGTTATCATGTAAAGAT
rJMFF032C14+ AAATGGTTGGTCCAACCTTACGTTGAACGGATGCATTTGCTGTAGTTATCATGTAAAGAT
                      ____________________________________________________________
consensus AAATGGTTGGTCCAACCTTACGTTGAACGGATGCATTTGCTGTAGTTATCATGTAAAGAT
 
. : . : . : . : . : . :
rJMFF039C03+ TCTTGTATTCGGATTTCCTAAGGAATCAGTGTGCTAACTTGTATGAGCGTTCAGTGTAAT
rJMFF010G22+ TCTTGTATTCGGATTTCCTAAGGAATCAGTGTGCTAACTTGTATGAGCGTTCAGTGTAAT
rJMFF032C14+ TCTTGTATTCGGATTTCCTAAGGAATCAGTGTGCTAACTTGTATGAGCGTTCAGTGTAAT
                      ____________________________________________________________
consensus TCTTGTATTCGGATTTCCTAAGGAATCAGTGTGCTAACTTGTATGAGCGTTCAGTGTAAT
 
. : . : . : . : . : . :
rJMFF039C03+ ATTACT
rJMFF010G22+ ATTACT
rJMFF032C14+ ATTACTTGGTTTTCTTTCTTTTCTGAGTTGCCAAATGATGGATCTTAGCGCTGCATTATG
                      ____________________________________________________________
consensus ATTACTTGGTTTTCTTTCTTTTCTGAGTTGCCAAATGATGGATCTTAGCGCTGCATTATG