Previous Contig 009701:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032C02Sequence548009701 (4)gb:AP004020_18364678e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11694009701 (4)gb:AP004020_18364673e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11
JMSF017E17Sequence522009701 (4)gb:AP004020_18364671e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11694009701 (4)gb:AP004020_18364673e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF017E17- GATCAT
JMFF032C02- ATCAT
rJMSF017E17+ ATCAT
                      ____________________________________________________________
consensus GATCAT
 
. : . : . : . : . : . :
JMSF017E17- TTAACCTCAAGTTTCCTACTCCTCATCTCCGCCACCGCGAGCCGCTCACCGGCACAGAGT
JMFF032C02- TTAACCTCAAGTTTCCTACTCCTCATCTCCGCCACCGCGAGCCGCTCACCGGCACAGAGT
rJMSF017E17+ TTAACCTCAAGTTTCCTACTCCTCATCTCCGCCACCGCGAGCCGCTCACCGGCACAGAGT
rJMFF032C02+ TCTCCGCCACCGCGAGCCGCTCACCGGCACAGAGT
                      ____________________________________________________________
consensus TTAACCTCAAGTTTCCTACTCCTCATCTCCGCCACCGCGAGCCGCTCACCGGCACAGAGT
 
. : . : . : . : . : . :
JMSF017E17- TGCAGTTTGCCGCGGGGATTCACGTCACCGGAGCGTGATCTTCTGAAAATCCTGTCTGCA
JMFF032C02- TGCAGTTTGCCGCGGGGATTCACGTCACCGGAGCGTGATCTTCTGAAAATCCTGTCTGCA
rJMSF017E17+ TGCAGTTTGCCGCGGGGATTCACGTCACCGGAGCGTGATCTTCTGAAAATCCTGTCTGCA
rJMFF032C02+ TGCAGTTTGCCGCGGGGATTCACGTCACCGGAGCGTGATCTTCTGAAAATCCTGTCTGCA
                      ____________________________________________________________
consensus TGCAGTTTGCCGCGGGGATTCACGTCACCGGAGCGTGATCTTCTGAAAATCCTGTCTGCA
 
. : . : . : . : . : . :
JMSF017E17- TAGCGCCATGAATTCTCGGAGGGATCGCAATACTAGAACTGCTCTGTTTGATGGTATTGA
JMFF032C02- TAGCGCCATGAATTCTCGGAGGGATCGCAATACTAGAACTGCTCTGTTTGATGGTATTGA
rJMSF017E17+ TAGCGCCATGAATTCTCGGAGGGATCGCAATACTAGAACTGCTCTGTTTGATGGTATTGA
rJMFF032C02+ TAGCGCCATGAATTCTCGGAGGGATCGCAATACTAGAACTGCTCTGTTTGATGGTATTGA
                      ____________________________________________________________
consensus TAGCGCCATGAATTCTCGGAGGGATCGCAATACTAGAACTGCTCTGTTTGATGGTATTGA
 
. : . : . : . : . : . :
JMSF017E17- GGAAGGTGGCATTAGGGCTTCATCATCATACTCTTCTCATGAGATTGATGAACATGAGAA
JMFF032C02- GGAAGGTGGCATTAGGGCTTCATCATCATACTCTTCTCATGAGATTGATGAACATGAGAA
rJMSF017E17+ GGAAGGTGGCATTAGGGCTTCATCATCATACTCTTCTCATGAGATTGATGAACATGAGAA
rJMFF032C02+ GGAAGGTGGCATTAGGGCTTCATCATCATACTCTTCTCATGAGATTGATGAACATGAGAA
                      ____________________________________________________________
consensus GGAAGGTGGCATTAGGGCTTCATCATCATACTCTTCTCATGAGATTGATGAACATGAGAA
 
. : . : . : . : . : . :
JMSF017E17- TGAAAAAGCACTGGATGGACTGCAAGATAGAGTCAATCTGCTGAAAAGATTGTCAGGTGA
JMFF032C02- TGAAAAAGCACTGGATGGACTGCAAGATAGAGTCAATCTGCTGAAAAGATTGTCAGGTGA
rJMSF017E17+ TGAAAAAGCACTGGATGGACTGCAAGATAGAGTCAATCTGCTGAAAAGATTGTCAGGTGA
rJMFF032C02+ TGAAAAAGCACTGGATGGACTGCAAGATAGAGTCAATCTGCTGAAAAGATTGTCAGGTGA
                      ____________________________________________________________
consensus TGAAAAAGCACTGGATGGACTGCAAGATAGAGTCAATCTGCTGAAAAGATTGTCAGGTGA
 
. : . : . : . : . : . :
JMSF017E17- TATACATGAGGAGGTAGACACCCATAATCGCATGCTGGACAGAATGGGCAATGACATGGA
JMFF032C02- TATACATGAGGAGGTAGACACCCATAATCGCATGCTGGACAGAATGGGCAATGACATGGA
rJMSF017E17+ TATACATGAGGAGGTAGACACCCATAATCGCATGCTGGACAGAATGGGCAATGACATGGA
rJMFF032C02+ TATACATGAGGAGGTAGACACCCATAATCGCATGCTGGACAGAATGGGCAATGACATGGA
                      ____________________________________________________________
consensus TATACATGAGGAGGTAGACACCCATAATCGCATGCTGGACAGAATGGGCAATGACATGGA
 
. : . : . : . : . : . :
JMSF017E17- TGCTTCAAGGGGAGTGTTATCTGGAACCATGGACAAATTCAAGATGGTATTCGAGACGAA
JMFF032C02- TGCTTCAAGGGGAGTGTTATCTGGAACCATGGACAAATTCAAGATGGTATTCGAGACGAA
rJMSF017E17+ TGCTTCAAGGGGAGTGTTATCTGGAACCATGGACAAATTCAAGATGGTATTCGAGACGAA
rJMFF032C02+ TGCTTCAAGGGGAGTGTTATCTGGAACCATGGACAAATTCAAGATGGTATTCGAGACGAA
                      ____________________________________________________________
consensus TGCTTCAAGGGGAGTGTTATCTGGAACCATGGACAAATTCAAGATGGTATTCGAGACGAA
 
. : . : . : . : . : . :
JMSF017E17- ATCAAGCCGGAGGATGTTCACTCTTGTGGCATCTTTTGTGGTTCTC-TTTCTGGTGGTGT
JMFF032C02- ATCAAGCCGGAGGATGTTCACTCTTGTGGCATCTTTTGTGGTTCTCTTTTCTGGTGGTGT
rJMSF017E17+ ATCAAGCCGGAGGATGTTCACTCTTGTGGCATCTTTTGTGGTTCTC-TTTCTGGTGGTGT
rJMFF032C02+ ATCAAGCCGGAGGATGTTCACTCTTGTGGCATCTTTTGTGGTTCTC-TTTCTGGTGGTGT
                      ____________________________________________________________
consensus ATCAAGCCGGAGGATGTTCACTCTTGTGGCATCTTTTGTGGTTCTC-TTTCTGGTGGTGT
 
. : . : . : . : . : . :
JMSF017E17- ACTATCTCACCAGGTAAATAGTGACGAGCGTTCGGAT
JMFF032C02- ACTATCTCACCAGGTAAATAGTGACGAGCGTTCGGATATCTACTGGTTTTATAGCTGTTG
rJMSF017E17+ ACTATCTCACCAGGTAAATAGTGACGAGCGTTCGGATATCTACTGGTTTTATAGCTGTTG
rJMFF032C02+ ACTATCTCACCAGGTAAATAGTGACGAGCGTTCGGATATCTACTGGTTTTATAGCTGTTG
                      ____________________________________________________________
consensus ACTATCTCACCAGGTAAATAGTGACGAGCGTTCGGATATCTACTGGTTTTATAGCTGTTG
 
. : . : . : . : . : . :
JMFF032C02- ATA
rJMSF017E17+ ATACCAGATTCACATTGATCATATAATGCTGTCTACATCACCCTCTCACAGCCTTAATAT
rJMFF032C02+ ATACCAGATTCACATTGATCATATAATGCTGTCTACATCACCCTCTCACAGCCTTAATAT
                      ____________________________________________________________
consensus ATACCAGATTCACATTGATCATATAATGCTGTCTACATCACCCTCTCACAGCCTTAATAT
 
. : . : . : . : . : . :
rJMSF017E17+ CCGAACGTATCTGTAAAGATGTTTGATGAAAAATTTAAATACTTTTTGAATAGTATGCCT
rJMFF032C02+ CCGAACGTATCTGTAAAGATGTTTGATGAAAAATTTAAATACTTTTTGAATAGTATGCCT
                      ____________________________________________________________
consensus CCGAACGTATCTGTAAAGATGTTTGATGAAAAATTTAAATACTTTTTGAATAGTATGCCT
 
. : . : . : . : . : . :
rJMSF017E17+ TCTGGTTCTGGAATGGATATAATGACAAC
rJMFF032C02+ TCTGGTTCTGGAATGGATATAATGACAACACTAGTGGTTGTTACCTTGTTATACATACCA
                      ____________________________________________________________
consensus TCTGGTTCTGGAATGGATATAATGACAACACTAGTGGTTGTTACCTTGTTATACATACCA