Previous Contig 009699:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032B10Sequence488009699 (6)gb:AY085538_15706073e-49Arabidopsis thaliana clone 156450 mRNA, complete sequence.739009699 (6)pir|T50664|T50664e-105methylenetetrahydrofolate dehydrogenase (NADP) (EC 1.5.1.5) / methenyltetrahydro
JMSF027A02Sequence644009699 (6)gb:AY085538_15706073e-73Arabidopsis thaliana clone 156450 mRNA, complete sequence.755009699 (6)pir|T50664|T50664e-112methylenetetrahydrofolate dehydrogenase (NADP) (EC 1.5.1.5) / methenyltetrahydro
JMSF036A13Sequence633009699 (6)gb:AY085538_15706077e-74Arabidopsis thaliana clone 156450 mRNA, complete sequence.754009699 (6)pir|T50664|T50664e-111methylenetetrahydrofolate dehydrogenase (NADP) (EC 1.5.1.5) / methenyltetrahydro

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027A02- GATCGGCGAGGAGGAGAGCATAAACATCACTACATCGACGCAGTCGA
JMFF032B10- ACATCGACGCAGTCGA
JMSF036A13- GAGCATAAACATCACTACATCGACGCAGTCGA
                      ____________________________________________________________
consensus GATCGGCGAGGAGGAGAGCATAAACATCACTACATCGACGCAGTCGA
 
. : . : . : . : . : . :
JMSF027A02- CGAGTTCCGGATAAAGGTCTGTACACTGGAAACGCAATACCGCCGTCGCCCTGTCAGGAA
JMFF032B10- CGAGTTCCGGATAAAGGTCTGTGCACTGGAAACGCAATACCGCCGTCGCCCTGTCAGGAA
JMSF036A13- CGAGTTCCGGATAAAGGTCTGTGCACTGGAAACGCAATACCGCCGTCGCCCTGTCAGGAA
                      ____________________________________________________________
consensus CGAGTTCCGGATAAAGGTCTGTGCACTGGAAACGCAATACCGCCGTCGCCCTGTCAGGAA
 
. : . : . : . : . : . :
JMSF027A02- TCATCTCATTTGCGCCGTGAATCCACCCAGCTCGAGCTGCAATGTCATCAGGATCAGATC
JMFF032B10- TCATCTCATTTGCGCCGTGAATCCACCCAGCTCGAGCTGCAATGTCATCAGGATCAGATC
JMSF036A13- TCATCTCATTTGCGCCGTGAATCCACCCAGCTCGAGCTGCAATGTCATCAGGATCAGATC
                      ____________________________________________________________
consensus TCATCTCATTTGCGCCGTGAATCCACCCAGCTCGAGCTGCAATGTCATCAGGATCAGATC
 
. : . : . : . : . : . :
JMSF027A02- ATCAAGCCACCGTCATAGATGGTAAAGCTATTGCACAAACCATTCGATCTGAGATTGCCT
JMFF032B10- ATCAAGCCACCGTCATAGATGGTAAAGCTATTGCACAAACCATTCGATCTGAGATTGCCT
JMSF036A13- ATCAAGCCACCGTCATAGATGGTAAAGCTATTGCACAAACCATTCGATCTGAGATTGCCT
                      ____________________________________________________________
consensus ATCAAGCCACCGTCATAGATGGTAAAGCTATTGCACAAACCATTCGATCTGAGATTGCCT
 
. : . : . : . : . : . :
JMSF027A02- CGGAAATAAAAGTCATGTTGGAGAAGTATGGCCAGGTGCCAGGGTTGGCAGTAGTCATTG
JMFF032B10- CGGAAATAAAAGTCATGTTGGAGAAGTATGGCCAGGTGCCAGGGTTGGCAGTAGTCATTG
JMSF036A13- CGGAAATAAAAGTCATGTTGGAGAAGTATGGCCAGGTGCCAGGGTTGGCAGTAGTCATTG
                      ____________________________________________________________
consensus CGGAAATAAAAGTCATGTTGGAGAAGTATGGCCAGGTGCCAGGGTTGGCAGTAGTCATTG
 
. : . : . : . : . : . :
JMSF027A02- TAGGAAATCGGAAAGATTCTCAAAGCTATGTGAATATGAAGAGAAAGTCTTGTGCTGAAG
JMFF032B10- TAGGAAATCGGAAAGATTCTCAAAGCTATGTGAATATGAAGAGAAAGTCTTGTGCTGAAG
JMSF036A13- TAGGAAATCGGAAAGATTCTCAAAGCTATGTGAATATGAAGAGAAAGTCTTGTGCTGAAG
rJMSF036A13+ CTGAAG
rJMSF027A02+ GCTGAAG
                      ____________________________________________________________
consensus TAGGAAATCGGAAAGATTCTCAAAGCTATGTGAATATGAAGAGAAAGTCTTGTGCTGAAG
 
. : . : . : . : . : . :
JMSF027A02- TTGGGATTAAGTCCTTTGACATCAACCTTCCAGAGGATGTACCTGAAGCTGAATTAATTA
JMFF032B10- TTGGGATTAAGTCCTTTGACATCAACCTTCCAGAGGATGTACCTGAAGCTGAATTAATTA
JMSF036A13- TTGGGATTAAGTCCTTTGACATCAACCTTCCAGAGGATGTACCTGAAGCTGAATTAATTA
rJMSF036A13+ TTGGGATTAAGTNCTTTGACATCANCCTTCCAGAGGATGTACCTGAAGCTGAATTAATTA
rJMSF027A02+ TTGGGATTAAGTCCTTTGACATCAACCTTCCAGAGGATGTACCTGAAGCTGAATTAATTA
rJMFF032B10+ CCTGAAGCTGAATTAATTA
                      ____________________________________________________________
consensus TTGGGATTAAGTCCTTTGACATCAACCTTCCAGAGGATGTACCTGAAGCTGAATTAATTA
 
. : . : . : . : . : . :
JMSF027A02- GCAAGGTCCATGAGCTGAATGCTAATCCCGATGTGCATGGTATATTGGTGCAGCTTCCGC
JMFF032B10- GCAAGGTCCATGAGCTGAATGCTAATCCCGATGTGCATGGTATATTGGTGCAGCTTCCGC
JMSF036A13- GCAAGGTCCATGAGCTGAATGCTAATCCCGATGTGCATGGTATATTGGTGCAGCTTCCGC
rJMSF036A13+ GCAAGGTCCATGAGCTGAATGCTAATCCCGATGTGCATGGTATATTGGTGCAGCTTCCGC
rJMSF027A02+ GCAAGGTCCATGAGCTGAATGCTAATCCCGATGTGCATGGTATATTGGTGCAGCTTCCGC
rJMFF032B10+ GCAAGGTCCATGAGCTGAATGCTAATCCCGATGTGCATGGTATATTGGTGCAGCTTCCGC
                      ____________________________________________________________
consensus GCAAGGTCCATGAGCTGAATGCTAATCCCGATGTGCATGGTATATTGGTGCAGCTTCCGC
 
. : . : . : . : . : . :
JMSF027A02- TACCAAAACATATAAATGAAGAAAAAGTATTAGGCGAAATCAGTCTGGAGAAGGATGTAG
JMFF032B10- TACCAAAACATATAAATGAAGAAAAAGTATTAGGCGAAATCAGTCTGGAGAA
JMSF036A13- TACCAAAACATATAAATGAAGAAAAAGTATTAGGCGAAATCAGTCTGGAGAAGGATGTAG
rJMSF036A13+ TACCAAAACATATAAATGAAGAAAAAGTATTAGGCGAAATCAGTCTGGAGAAGGATGTAG
rJMSF027A02+ TACCAAAACATATAAATGAAGAAAAAGTATTAGGCGAAATCAGTCTGGAGAAGGATGTAG
rJMFF032B10+ TACCAAAACATATAAATGAAGAAAAAGTATTAGGCGAAATCAGTCTGGAGAAGGATGTAG
                      ____________________________________________________________
consensus TACCAAAACATATAAATGAAGAAAAAGTATTAGGCGAAATCAGTCTGGAGAAGGATGTAG
 
. : . : . : . : . : . :
JMSF027A02- ATGGCTTTCATCCTCTAAACATTGGCAAGCTTGCAATGAAAGGCAGAGATCCTTTGTTCC
JMSF036A13- ATGGCTTTCATCCTCTAAACATTGGCAAGCTTGCAATGAAAGGCAGAGATCCTTTGTTCC
rJMSF036A13+ ATGGCTTTCATCCTCTAAACATTGGCAAGCTTGCAATGAAAGGCAGAGATCCTTTGTTCC
rJMSF027A02+ ATGGCTTTCATCCTCTAAACATTGGCAAGCTTGCAATGAAAGGCAGAGATCCTTTGTTCC
rJMFF032B10+ ATGGCTTTCATCCTCTAAACATTGGCAAGCTTGCAATGAAAGGCAGAGATCCTTTGTTCC
                      ____________________________________________________________
consensus ATGGCTTTCATCCTCTAAACATTGGCAAGCTTGCAATGAAAGGCAGAGATCCTTTGTTCC
 
. : . : . : . : . : . :
JMSF027A02- TTCCATGCACCCCAAAGGGTTGCCTTGAACTTCTATTCCGAAGTGGTGTTACCATAA
JMSF036A13- TTCCATGCACCCCAAAGGGTTGCCTTGAACTTCTATTCCGAAGTGGTGTTACCATAAAAG
rJMSF036A13+ TTCCATGCACCCCAAAGGGTTGCCTTGAACTTCTATTCCGAAGTGGTGTTACCATAAAAG
rJMSF027A02+ TTCCATGCACCCCAAAGGGTTGCCTTGAACTTCTATTCCGAAGTGGTGTTACCATAAAAG
rJMFF032B10+ TTCCATGCACCCCAAAGGGTTGCCTTGAACTTCTATTCCGAAGTGGTGTTACCATAAAAG
                      ____________________________________________________________
consensus TTCCATGCACCCCAAAGGGTTGCCTTGAACTTCTATTCCGAAGTGGTGTTACCATAAAAG
 
. : . : . : . : . : . :
rJMSF036A13+ GGAAGAAGGCAGTTGTGGTTGGTCGAAGCAACATTGTTGGATTGCCAGTTTCGTTGCTAC
rJMSF027A02+ GGAAGAAGGCAGTTGTGGTTGGTCGAAGCAACATTGTTGGATTGCCAGTTTCGTTGCTAC
rJMFF032B10+ GGAAGAAGGCAGTTGTGGTTGGTCGAAGCAACATTGTTGGATTGCCAGTTTCGTTGCTAC
                      ____________________________________________________________
consensus GGAAGAAGGCAGTTGTGGTTGGTCGAAGCAACATTGTTGGATTGCCAGTTTCGTTGCTAC
 
. : . : . : . : . : . :
rJMSF036A13+ TTCTGAAGGAAGATGCAACTGTCACTATAGTCCATTCTCGCACTAAGGATCCAGAGAGCT
rJMSF027A02+ TTCTGAAGGAAGATGCAACTGTCACTATAGTCCATTCTCGCACTAAGGATCCAGAGAGCT
rJMFF032B10+ TTCTGAAGGAAGATGCAACTGTCACTATAGTCCATTCTCGCACTAAGGATCCAGAGAGCT
                      ____________________________________________________________
consensus TTCTGAAGGAAGATGCAACTGTCACTATAGTCCATTCTCGCACTAAGGATCCAGAGAGCT
 
. : . : . : . : . : . :
rJMSF036A13+ TCATTCGCGAAGCAGACATTGTTATTGCAGCAGCAGGACAGCCAATGATGATCAAAGGAA
rJMSF027A02+ TCATTCGCGAAGCAGACATTGTTATTGCAGCAGCAGGACAGCCAATGATGATCAAAGGAA
rJMFF032B10+ TCATTCGCGAAGCAGACATTGTTATTGCAGCAGCAGGACAGCCAATGATGATCAAAGGAA
                      ____________________________________________________________
consensus TCATTCGCGAAGCAGACATTGTTATTGCAGCAGCAGGACAGCCAATGATGATCAAAGGAA
 
. : . : . : . : . : . :
rJMSF036A13+ GCTGGATTAAACCCGGAGCTGCTGTGATTGATGTTGGAACAAATGCTGTAGACGATCCAA
rJMSF027A02+ GCTGGATTAAACCCGGAGCTGCTGTGATTGATGTTGGAACAAATGCTGTAGACGATCCAA
rJMFF032B10+ GCTGGATTAAACCCGGAGCTGCTGTGATTGATGTTGGAACAAATGCTGTAGACGATCCAA
                      ____________________________________________________________
consensus GCTGGATTAAACCCGGAGCTGCTGTGATTGATGTTGGAACAAATGCTGTAGACGATCCAA
 
. : . : . : . : . : . :
rJMSF036A13+ CTAAGAAATCGGGTTATAGGCTCGTGGGTGATGTCGATTTTCAGGAAGCGTCCAAGGTAG
rJMSF027A02+ CTAAGAAATCGGGTTATAGGCTCGTGGGTGATGTCGATTTTCAGGAAGCGTCCAAGGTAG
rJMFF032B10+ CTAAGAAATCGGGTTATAGGCTCGTGGGTGATGTCGATTTTCAGGAAGCGTCCAAGGTAG
                      ____________________________________________________________
consensus CTAAGAAATCGGGTTATAGGCTCGTGGGTGATGTCGATTTTCAGGAAGCGTCCAAGGTAG
 
. : . : . : . : . : . :
rJMSF036A13+ CTGGATGCATAACTCCAGTTCCTGGTGGCGTCGGGCCACTAACAGTCGCAATGCTTCTGA
rJMSF027A02+ CTGGATGCATAACTCCAGTTCCTGGTGGCGTCGGGCCACTAACAGTCGCAATGCTTCTGA
rJMFF032B10+ CTGGATGCATAACTCCAGTTCCTGGTGGCGTCGGGCCACTAACAGTCGCAATGCTTCTGA
                      ____________________________________________________________
consensus CTGGATGCATAACTCCAGTTCCTGGTGGCGTCGGGCCACTAACAGTCGCAATGCTTCTGA
 
. : . : . : . : . : . :
rJMSF036A13+ AGAATACATTGGATGGAGCTAAACGAGTTATTGAGAAGTAGCCTTGTTGTTTTGTTGGAT
rJMSF027A02+ AGAATACATTGGATGGAGCTAAACGAGTTATTGAGAAGTAGCCTTGTTGTTTTGTTGGAT
rJMFF032B10+ AGAATACATTGGATGGAGCTAAACGAGTTATTGAGAAGTAGCCTTGTTGTTTTGTTGGAT
                      ____________________________________________________________
consensus AGAATACATTGGATGGAGCTAAACGAGTTATTGAGAAGTAGCCTTGTTGTTTTGTTGGAT
 
. : . : . : . : . : . :
rJMSF036A13+ TTTAAGGCACTGTCTAAGTTGAAGTTTA
rJMSF027A02+ TTTAAGGCACTGTCTAAGTTGAAGTTTA
rJMFF032B10+ TTTAAGGCACTGTCTAAGTTGAAGTTTATGAGTTTATCAACCTTTCCTGAAGCTCAAGAA
                      ____________________________________________________________
consensus TTTAAGGCACTGTCTAAGTTGAAGTTTATGAGTTTATCAACCTTTCCTGAAGCTCAAGAA