Previous Contig 009697:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001P17Sequence531000994 (6)gb:AY598342_16171165e-50Solanum tuberosum purple acid phosphatase 3 (PAP3) mRNA, complete cds.705009697 (6)gb:AY598342_16171163e-73Solanum tuberosum purple acid phosphatase 3 (PAP3) mRNA, complete cds.
JMFF019M11Sequence546000994 (6)gb:AB116719_15276213e-25Phaseolus vulgaris mRNA for acid phosphatase, complete cds.>gb:AB116720_1527622 756009697 (6)gb:AY050812_15623165e-84Arabidopsis thaliana putative acid phosphatase (At5g34850) mRNA, complete cds.>g
JMFF031P21Sequence627000994 (6)gb:AY842026_16306488e-43Arabidopsis thaliana putative purple acid phosphatase (PAP26) mRNA, complete cds732009697 (6)gb:AY598342_16171164e-73Solanum tuberosum purple acid phosphatase 3 (PAP3) mRNA, complete cds.
JMFF043H22Sequence652000994 (6)gb:AY842026_16306488e-47Arabidopsis thaliana putative purple acid phosphatase (PAP26) mRNA, complete cds431009697 (6)gb:AY598342_16171163e-38Solanum tuberosum purple acid phosphatase 3 (PAP3) mRNA, complete cds.
JMSF049G10Sequence661000994 (6)gb:AB116719_15276212e-73Phaseolus vulgaris mRNA for acid phosphatase, complete cds.>gb:AB116720_1527622 746009697 (6)gb:AY050812_15623161e-88Arabidopsis thaliana putative acid phosphatase (At5g34850) mRNA, complete cds.>g
JMSF052K02Sequence661000994 (6)gb:AB116719_15276218e-74Phaseolus vulgaris mRNA for acid phosphatase, complete cds.>gb:AB116720_1527622 917009697 (6)gb:AY598342_1617116e-107Solanum tuberosum purple acid phosphatase 3 (PAP3) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052K02+ CTTTAGATATCCCACGCCCTATAA
                      ____________________________________________________________
consensus CTTTAGATATCCCACGCCCTATAA
 
. : . : . : . : . : . :
rJMSF052K02+ AGCCTCCAAGAGTACCAATCAGCTTTGGTATGCAATCAGGCGGGCATCTGCTCATATAAT
                      ____________________________________________________________
consensus AGCCTCCAAGAGTACCAATCAGCTTTGGTATGCAATCAGGCGGGCATCTGCTCATATAAT
 
. : . : . : . : . : . :
rJMSF049G10+ AAATATACGCCTCAGTGGAAGTGGTTAAGAGA
rJMFF019M11+ GGAAGTGGTTAAGAGA
rJMSF052K02+ TGTTCTATCCACCTACTCCCCATTTGTAAAATATACGCCTCAGTGGAAGTGGTTAAGAGA
                      ____________________________________________________________
consensus TGTTCTATCCACCTACTCCCCATTTGTAAAATATACGCCTCAGTGGAAGTGGTTAAGAGA
 
. : . : . : . : . : . :
rJMSF049G10+ AGAACTTACAAGGGTGGACAGGGAGAAGACTCCTTGGCTAATTGTCCTCATGCACGTTCC
rJMFF019M11+ AGAACTTACAAGGGTGGACAGGGAGAAGACTCCTTGGCTAATTGTCCTCATGCACGTTCC
rJMFF001P17+ TCATGCACGTTCC
rJMSF052K02+ AGAACTTACAAGGGTGGACAGGGAGAAGACTCCTTGGCTAATTGTCCTCATGCACGTTCC
rJMFF031P21+ CATGCACGTTCC
                      ____________________________________________________________
consensus AGAACTTACAAGGGTGGACAGGGAGAAGACTCCTTGGCTAATTGTCCTCATGCACGTTCC
 
. : . : . : . : . : . :
rJMSF049G10+ TATCTACAATAGCAATGTAGCCCACTTTATGGAGGGTGAAAGTATGAGAACTGTCTATGA
rJMFF019M11+ TATCTACAATAGCAATGTAGCCCACTTTATGGAGGGTGAAAGTATGAGAACTGTCTATGA
rJMFF001P17+ TATCTACAATAGCAATGTAGCCCACTTTATGGAGGGTGAAAGTATGAGAACTGTCTATGA
rJMSF052K02+ TATCTACAATAGCAATGTAGCCCACTTTATGGAGGGTGAAAGTATGAGAACTGTCTATGA
rJMFF031P21+ TATCTACAATAGCAATGTAGCCCACTTTATGGAGGGTGAAAGTATGAGAACTGTCTATGA
                      ____________________________________________________________
consensus TATCTACAATAGCAATGTAGCCCACTTTATGGAGGGTGAAAGTATGAGAACTGTCTATGA
 
. : . : . : . : . : . :
rJMSF049G10+ GGAGTGGTTTGTCAAATACAAAGTTGACGTGGTATTTGCCGGTCATGTCCATGCTTATGA
rJMFF019M11+ GGAGTGGTTTGTCAAATACAAAGTTGACGTGGTATTTGCCGGTCATGTCCATGCTTATGA
rJMFF001P17+ GGAGTGGTTTGTCAAATACAAAGTTGACGTGGTATTTGCCGGTCATGTCCATGCTTATGA
rJMSF052K02+ GGAGTGGTTTGTCAAATACAAAGTTGACGTGGTATTTGCCGGTCATGTCCATGCTTATGA
rJMFF031P21+ GGAGTGGTTTGTCAAATACAAAGTTGACGTGGTATTTGCCGGTCATGTCCATGCTTATGA
                      ____________________________________________________________
consensus GGAGTGGTTTGTCAAATACAAAGTTGACGTGGTATTTGCCGGTCATGTCCATGCTTATGA
 
. : . : . : . : . : . :
rJMSF049G10+ GCGATCATACCGCATATCAAACATCCACTATAATGTATCAAGTGGTATTGCTTATCCTGT
rJMFF019M11+ GCGATCATACCGCATATCAAACATCCACTATAATGTATCAAGTGGTATTGCTTATCCTGT
rJMFF043H22+ TGCTTATCCTGT
rJMFF001P17+ GCGATCATACCGCATATCAAACATCCACTATAATGTATCAAGTGGTATTGCTTATCCTGT
rJMSF052K02+ GCGATCATACCGCATATCAAACATCCACTATAATGTATCAAGTGGTATTGCTTATCCTGT
rJMFF031P21+ GCGATCATACCGCATATCAAACATCCACTATAATGTATCAAGTGGTATTGCTTATCCTGT
                      ____________________________________________________________
consensus GCGATCATACCGCATATCAAACATCCACTATAATGTATCAAGTGGTATTGCTTATCCTGT
 
. : . : . : . : . : . :
rJMSF049G10+ ACCAGACAAATCAGCTCCTGTTTACATTACTGTTGGAGATGGAGGGAACCAGGAAGGTCT
rJMFF019M11+ ACCAGACAAATCAGCTCCTGTTTACATTACTGTTGGAGATGGAGGGAACCAGGAAGGTCT
rJMFF043H22+ ACCAGACAAATCAGCTCCTGTTTACATTACTGTTGGAGATGGAGGGAACCAGGAAGGTTT
rJMFF001P17+ ACCAGACAAATCAGCTCCTGTTTACATTACTGTTGGAGATGGAGGGAACCAGGAAGGTCT
rJMSF052K02+ ACCAGACAAATCAGCTCCTGTTTACATTACTGTTGGAGATGGAGGGAACCAGGAAGGTCT
rJMFF031P21+ ACCAGACAAATCAGCTCCTGTTTACATTACTGTTGGAGATGGAGGGAACCAGGAAGGTCT
                      ____________________________________________________________
consensus ACCAGACAAATCAGCTCCTGTTTACATTACTGTTGGAGATGGAGGGAACCAGGAAGGTCT
 
. : . : . : . : . : . :
rJMSF049G10+ TGCTGGAAGATTTAGAGATCCCCAGCCTGAGTACTCTGCTTTTCGCGAAGCTAGTTATGG
rJMFF019M11+ TGCTGGAAGATTTAGAGATCCCCAGCCTGAGTACTCTGCTTTTCGCGAAGCTAGTTATGG
rJMFF043H22+ TGCTGCAAGATTTAGAGATCCCCAGCCTGAGTACTTTGCTTTTTGCGAAGCTAGTTATGG
rJMFF001P17+ TGCTGGAAGATTTAGAGATCCCCAGCCTGAGTACTCTGCTTTTCGCGAAGCTAGTTATGG
rJMSF052K02+ TGCTGGAAGATTTAGAGATCCCCAGCCTGAGTACTCTGCTTTTCGCGAAGCTAGTTATGG
rJMFF031P21+ TGCTGGAAGATTTAGAGATCCCCAGCCTGAGTACTCTGCTTTTCGCGAAGCTAGTTATGG
                      ____________________________________________________________
consensus TGCTGGAAGATTTAGAGATCCCCAGCCTGAGTACTCTGCTTTTCGCGAAGCTAGTTATGG
 
. : . : . : . : . : . :
rJMSF049G10+ CCATTCTACATTAGAGATAAAGAATAGAACACATGCATTCTATCATTGGAACCGGAATGA
rJMFF019M11+ CCATTCTACATTAGAGATAAAGAATAGAACACATGCATTCTATCATTGGAACCGGAATGA
rJMFF043H22+ CCATTTTTCATTAGAGATAAAGAATAGAACCCATGCATTTTATCATTGGAACCGGAATGA
rJMFF001P17+ CCATTCTACATTAGAGATAAAGAATAGAACACATGCATTCTATCATTGGAACCGGAATGA
rJMSF052K02+ CCATTCTACATTAGAGATAAAGAATAGAACACATGCATTCTATCATTGGAACCGGAATGA
rJMFF031P21+ CCATTCTACATTAGAGATAAAGAATAGAACACATGCATTCTATCATTGGAACCGGAATGA
                      ____________________________________________________________
consensus CCATTCTACATTAGAGATAAAGAATAGAACACATGCATTCTATCATTGGAACCGGAATGA
 
. : . : . : . : . : . :
rJMSF049G10+ TGATGGAAAAAGAGTTGCAACTGACGCTTTTGTTCTACACAACCAGTTCTGGGGAAACAA
rJMFF019M11+ TGATGGAAAAAGAGTTGCAACTGACGCTTTTGTTCTACACAACCAGTTCTGGGGAAACAA
rJMFF043H22+ TGATGGAAAAAGAGTTGCAACTGACGCTTTTGTTTTACACAACCAGTTTTGGGGAAACAA
rJMFF001P17+ TGATGGAAAAAGAGTTGCAACTGACGCTTTTGTTCTACACAACCAGTTCTGGGGAAACAA
rJMSF052K02+ TGATGGAAAAAGAGTTGCAACTGACGCTTTTGTTCTACACAACCAGTTCTGGGGAAACAA
rJMFF031P21+ TGATGGAAAAAGAGTTGCAACTGACGCTTTTGTTCTACACAACCAGTTCTGGGGAAACAA
                      ____________________________________________________________
consensus TGATGGAAAAAGAGTTGCAACTGACGCTTTTGTTCTACACAACCAGTTCTGGGGAAACAA
 
. : . : . : . : . : . :
rJMSF049G10+ CCGGAGAAGGAGAAAGTTGAACAAATCCCGTCTTCAATCAGTCATTGTTAGCAGGTACTC
rJMFF019M11+ CCGGAGAAGGAGAAAGTTGAACAAATCCCGTCTTCAATCAGTCATTGTTAGCAGGTACTC
rJMFF043H22+ CCGGAGAAGGAGAAAGTTGAACAAATCCCGTTTTCAATCAGTCATTGTTAGCAGGTACTT
rJMFF001P17+ CCGGAGAAGGAGAAAGTTGAACAAATCCCGTCTTCAATCAGTCATTGTTAGCAGGTACTC
rJMSF052K02+ CCGGAGAAGGAGAAAGTTGAACAAATCCCGTCTTCAATCAGTCATTGTTAGCAGGTACTC
rJMFF031P21+ CCGGAGAAGGAGAAAGTTGAACAAATCCCGTCTTCAATCAGTCATTGTTAGCAGGTACTC
                      ____________________________________________________________
consensus CCGGAGAAGGAGAAAGTTGAACAAATCCCGTCTTCAATCAGTCATTGTTAGCAGGTACTC
 
. : . : . : . : . : . :
rJMSF049G10+ TACCGCGCCATTGTGAATCAGTCATTGTTCTCCATCACAACTGGCGATTTTGCTGCAGCA
rJMFF019M11+ TACCGCGCCATTGTGAATCAGTCATTGTTCTCCATCACAACTGGCGATTTTGCTGCAGCA
rJMFF043H22+ TTCCGCGCCATTGTGAATCAGTCATTGTTTTCCATCACAACTGGCGATTTTGCTGCAGCA
rJMFF001P17+ TACCGCGCCATTGTGAATCAGTCATTGTTCTCCATCACAACTGGCGATTTTGCTGCAGCA
rJMSF052K02+ TACCGCGCCATTGTGAATCAGTCATTGTTCTCCATCACAACTGGCGATTTTGCTGCAGCA
rJMFF031P21+ TACCGCGCCATTGTGAATCAGTCATTGTTCTCCATCACAACTGGCGATTTTGCTGCAGCA
                      ____________________________________________________________
consensus TACCGCGCCATTGTGAATCAGTCATTGTTCTCCATCACAACTGGCGATTTTGCTGCAGCA
 
. : . : . : . : . : . :
rJMSF049G10+ TTGAATCCTCGGCTGCTTTGTTGAGTTCAGGATTTCTGAGATGTGGCCTTACCGTAAATA
rJMFF019M11+ TTGAATCCTCGGCTGCTTTGTTGAGTTCAGGATTTCTGAGATGTGGCCTTACCGTAAATA
rJMFF043H22+ ATGAATCCTCGGCTGCTTTGTTGAGTTCAGGATTTTTGAGAAGTGGCC
rJMFF001P17+ TTGAATCCTCGGCTGCTTTGTTGAGTTCAGGATTTCTGAGATGTGGCCTTACCGTAAATA
rJMSF052K02+ TTGAATCCTCGGCTGCTTTGTTGAGTTCAGGATTTCTGAGATGTGGCCTTACCGTAAATA
rJMFF031P21+ TTGAATCCTCGGCTGCTTTGTTGAGTTCAGGATTTCTGAGATGTGGCCTTACCGTAAATA
                      ____________________________________________________________
consensus TTGAATCCTCGGCTGCTTTGTTGAGTTCAGGATTTCTGAGATGTGGCCTTACCGTAAATA
 
. : . : . : . : . : . :
rJMSF049G10+ ACAATTTCTGTTGTTTATATATGATCTGACCTTTTCTTTCTTTGATAATAATGT
rJMFF019M11+ ACAATTTCTGTTGTTTATATATGATCTGACCTTTTCTTTCTTTGATAATAATGTTATTGA
rJMFF001P17+ ACAATTTCTGTTGTTTATATATGATCTGACCTTTTCTTTCTTTGATAATAATGTTATTGA
rJMSF052K02+ ACAATTTCTGTTGTTTATATATGATCTGACCTTTTCTTTCTTTGATAATAATGTTATTGA
rJMFF031P21+ ACAATTTCTGTTGTTTATATATGATCTGACCTTTTCTTTCTTTGATAATAATGTTATTGA
                      ____________________________________________________________
consensus ACAATTTCTGTTGTTTATATATGATCTGACCTTTTCTTTCTTTGATAATAATGTTATTGA
 
. : . : . : . : . : . :
rJMFF019M11+ AGAATAGCA
rJMFF001P17+ AGAATAGCATGAAATAAAAAAGATGTTTT
rJMSF052K02+ AGAATAGCATGAAATAAAAAAGATGTTTTTGTGAATAATGTGAGATGTGTATA
rJMFF031P21+ AGAATAGCATGAAATAAAAAAGATGTTTTTGTGAATAATGTGAGATGTGTATATAAAATA
                      ____________________________________________________________
consensus AGAATAGCATGAAATAAAAAAGATGTTTTTGTGAATAATGTGAGATGTGTATATAAAATA