Previous Contig 009695:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031P14Sequence645006343 (5)gb:AY099685_15767102e-87Arabidopsis thaliana amino acid permease-like protein (At5g41800) mRNA, complete757009695 (3)gb:AY099685_15767102e-68Arabidopsis thaliana amino acid permease-like protein (At5g41800) mRNA, complete
JMSF026A12Sequence689006343 (5)gb:AY099685_15767103e-75Arabidopsis thaliana amino acid permease-like protein (At5g41800) mRNA, complete741009695 (3)gb:AY099685_15767104e-73Arabidopsis thaliana amino acid permease-like protein (At5g41800) mRNA, complete
JMSF028G14Sequence689006343 (5)gb:AY099685_15767103e-75Arabidopsis thaliana amino acid permease-like protein (At5g41800) mRNA, complete762009695 (3)gb:AY099685_15767102e-97Arabidopsis thaliana amino acid permease-like protein (At5g41800) mRNA, complete

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF028G14+ GCTGCCATTTTGGAAATGGTATTCTGCCTGAAATACAG
                      ____________________________________________________________
consensus GCTGCCATTTTGGAAATGGTATTCTGCCTGAAATACAG
 
. : . : . : . : . : . :
rJMSF028G14+ GCAACTCTTGCTCCACCAGTAACANGAAAGATGGTGAAAGGGCTCACAATGTGTTACTCT
                      ____________________________________________________________
consensus GCAACTCTTGCTCCACCAGTAACANGAAAGATGGTGAAAGGGCTCACAATGTGTTACTCT
 
. : . : . : . : . : . :
rJMSF028G14+ GTGATTCTTGTCACCTTCTATTCTGCTGCGGTGTCTGGATATTGGGCATTTGGAAACAAG
rJMSF026A12+ GGAAACAAG
                      ____________________________________________________________
consensus GTGATTCTTGTCACCTTCTATTCTGCTGCGGTGTCTGGATATTGGGCATTTGGAAACAAG
 
. : . : . : . : . : . :
rJMSF028G14+ TCCAATTCAAACATCCTCAAGAGCTTAATGCCAGATGATGGACCTTCATTGGCTCCAACA
rJMSF026A12+ TCCAATTCAAACATCCTCAAGAGCTTAATGCCAGATGATGGACCTTCATTGGCTCCAACA
rJMFF031P14+ CTTAATGCCAGATGATGGACCTTCATTGGCTCCAACA
                      ____________________________________________________________
consensus TCCAATTCAAACATCCTCAAGAGCTTAATGCCAGATGATGGACCTTCATTGGCTCCAACA
 
. : . : . : . : . : . :
rJMSF028G14+ TGGGTATTAGGTCTTGGGGTTATGTTTGTTCTTCTTCAGCTCTTCGCTATTGCCCTGGTG
rJMSF026A12+ TGGGTATTAGGTCTTGGGGTTATGTTTGTTCTTCTTCAGCTCTTCGCTATTGCCCTGGTG
rJMFF031P14+ TGGGTATTAGGTCTTGGGGTTATGTTTGTTCTTCTTCAGCTCTTCGCTATTGCCCTGGTG
                      ____________________________________________________________
consensus TGGGTATTAGGTCTTGGGGTTATGTTTGTTCTTCTTCAGCTCTTCGCTATTGCCCTGGTG
 
. : . : . : . : . : . :
rJMSF028G14+ TATTCTCAGGTGGCCTATGAAATAATGGAAACAAAATCTGCAGATGTGAACAAAGGGATG
rJMSF026A12+ TATTCTCAGGTGGCCTATGAAATAATGGAAACAAAATCTGCAGATGTGAACAAAGGGATG
rJMFF031P14+ TATTCTCAGGTGGCCTATGAAATAATGGAAACAAAATCTGCAGATGTGAACAAAGGGATG
                      ____________________________________________________________
consensus TATTCTCAGGTGGCCTATGAAATAATGGAAACAAAATCTGCAGATGTGAACAAAGGGATG
 
. : . : . : . : . : . :
rJMSF028G14+ TTCTCTAAGAGAAACTTAATTCCGAGGATAATTCTCCGGTCACTGTACATGGCACTGTGT
rJMSF026A12+ TTCTCTAAGAGAAACTTAATTCCGAGGATAATTCTCCGGTCACTGTACATGGCACTGTGT
rJMFF031P14+ TTCTCTAAGAGAAACTTAATTCCGAGGATAATTCTCCGGTCACTGTACATGGCACTGTGT
                      ____________________________________________________________
consensus TTCTCTAAGAGAAACTTAATTCCGAGGATAATTCTCCGGTCACTGTACATGGCACTGTGT
 
. : . : . : . : . : . :
rJMSF028G14+ GGGTTTTTTGCAGCTATGTTACCATTCTTTGGGGACATCAATGGCGTAGTTGGAGCAATT
rJMSF026A12+ GGGTTTTTTGCAGCTATGTTACCATTCTTTGGGGACATCAATGGCGTAGTTGGAGCAATT
rJMFF031P14+ GGGTTTTTTGCAGCTATGTTACCATTCTTTGGGGACATCAATGGCGTAGTTGGAGCAATT
                      ____________________________________________________________
consensus GGGTTTTTTGCAGCTATGTTACCATTCTTTGGGGACATCAATGGCGTAGTTGGAGCAATT
 
. : . : . : . : . : . :
rJMSF028G14+ GGGTTCATCCCTCTGGATTTCATTCTCCCAATGCTCCTCTACAACATGACTTTCAAACCC
rJMSF026A12+ GGGTTCATCCCTCTGGATTTCATTCTCCCAATGCTCCTCTACAACATGACTTTCAAACCC
rJMFF031P14+ GGGTTCATCCCTCTGGATTTCATTCTCCCAATGCTCCTCTACAACATGACTTTCAAACCC
                      ____________________________________________________________
consensus GGGTTCATCCCTCTGGATTTCATTCTCCCAATGCTCCTCTACAACATGACTTTCAAACCC
 
. : . : . : . : . : . :
rJMSF028G14+ TCCAAGTCATCCCTAACCTTCTGGATTAACAACTTAATCATTATAGTGTTCACAGGTGCA
rJMSF026A12+ TCCAAGTCATCCCTAACCTTCTGGATTAACAACTTAATCATTATAGTGTTCACAGGTGCA
rJMFF031P14+ TCCAAGTCATCCCTAACCTTCTGGATTAACAACTTAATCATTATAGTGTTCACAGGTGCA
                      ____________________________________________________________
consensus TCCAAGTCATCCCTAACCTTCTGGATTAACAACTTAATCATTATAGTGTTCACAGGTGCA
 
. : . : . : . : . : . :
rJMSF028G14+ GGACTTCTGGGCGCATTCTCTTCTATAAGGAAGTTGATCCTTGATGCCAATAAATTCAAG
rJMSF026A12+ GGACTTCTGGGCGCATTCTCTTCTATAAGGAAGTTGATCCTTGATGCCAATAAATTCAAG
rJMFF031P14+ GGACTTCTGGGCGCATTCTCTTCTATAAGGAAGTTGATCCTTGATGCCAATAAATTCAAG
                      ____________________________________________________________
consensus GGACTTCTGGGCGCATTCTCTTCTATAAGGAAGTTGATCCTTGATGCCAATAAATTCAAG
 
. : . : . : . : . : . :
rJMSF028G14+ CTGTTCAGTAGTGACGTTGTGGACTGACAACATTGTTGTATAAATTTGTCTCTATAAATA
rJMSF026A12+ CTGTTCAGTAGTGACGTTGTGGACTGACAACATTGTTGTATAAATTTGTCTCTATAAATA
rJMFF031P14+ CTGTTCAGTAGTGACGTTGTGGACTGACAACATTGTTGTATAAATTTGTCTCTATAAATA
                      ____________________________________________________________
consensus CTGTTCAGTAGTGACGTTGTGGACTGACAACATTGTTGTATAAATTTGTCTCTATAAATA
 
. : . : . : . : . : . :
rJMSF028G14+ GAAATGAATGCTCTGATCTTAGCTAGCTAGCTAAGCTAGCTTGTGCTTCATGTAATGTAA
rJMSF026A12+ GAAATGAATGCTCTGATCTTAGCTAGCTAGCTAAGCTAGCTTGTGCTTCATGTAATGTAA
rJMFF031P14+ GAAATGAATGCTCTGATCTTAGCTAGCTAGCTAAGCTAGCTTGTGCTTCATGTAATGTAA
                      ____________________________________________________________
consensus GAAATGAATGCTCTGATCTTAGCTAGCTAGCTAAGCTAGCTTGTGCTTCATGTAATGTAA
 
. : . : . : . : . : . :
rJMSF028G14+ TACT
rJMSF026A12+ TACTTAGCTCTAAACAGTTTGAATGTATAGACGTATAGTATACTACAAAGAAATGAGAAG
rJMFF031P14+ TACTTAGCTCTAAACAGTTTGAATGTATAGACGTATAGTATACTACAAAGAAATGAGAAG
                      ____________________________________________________________
consensus TACTTAGCTCTAAACAGTTTGAATGTATAGACGTATAGTATACTACAAAGAAATGAGAAG
 
. : . : . : . : . : . :
rJMSF026A12+ AAAATGGACGGTGCATGGTGTAGAGAGTTTTGAGGTGAATACACGCAATCATGCAAAAAT
rJMFF031P14+ AAAATGGACGGTGCATGGTGTAGAGAGTTTTGAGGTGAATACACGCAATCATGCAAAAAT
                      ____________________________________________________________
consensus AAAATGGACGGTGCATGGTGTAGAGAGTTTTGAGGTGAATACACGCAATCATGCAAAAAT
 
. : . : . : . : . : . :
rJMSF026A12+ TGTGGAGGAGTT
rJMFF031P14+ TGTGGAGGAGTTCACGTGTAGAACAATTGACTCCTTCAATTGTGAATCAATTAAGCCACA
                      ____________________________________________________________
consensus TGTGGAGGAGTTCACGTGTAGAACAATTGACTCCTTCAATTGTGAATCAATTAAGCCACA