Previous Contig 009681:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024I10Sequence435005311 (13)gb:AB025621_15164351e-59Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.747009681 (9)gb:AB025621_15164356e-82Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.
JMFF026F20Sequence614005311 (13)gb:AB025621_15164355e-84Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.759009681 (9)gb:AB025621_15164356e-76Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.
JMFF030J06Sequence383005311 (13)gb:AB025621_15164354e-51Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.723009681 (9)gb:AB025621_15164356e-78Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.
JMFF031I22Sequence562005311 (13)gb:AB025621_15164357e-72Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.774009681 (9)gb:AB025621_15164351e-82Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.
JMSF011O01Sequence310005311 (13)gb:AB025621_15164357e-34Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.753009681 (9)gb:AB025621_15164351e-83Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.
JMSF012F09Sequence236005311 (13)gb:AB025621_15164356e-16Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.789009681 (9)gb:AB025621_15164351e-77Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.
JMSF020D16Sequence676005311 (13)gb:AB025621_15164355e-95Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.757009681 (9)gb:AB025621_15164354e-84Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.
JMSF024K24Sequence695005311 (13)gb:AB025621_15164352e-94Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.771009681 (9)gb:AB025621_15164353e-80Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.
JMSF045B23Sequence140005311 (13)gb:AB025621_15164350.002Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.744009681 (9)gb:AB025621_15164354e-80Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFG13.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020D16+ TT
                      ____________________________________________________________
consensus TT
 
. : . : . : . : . : . :
rJMSF020D16+ CTCAACGGGTTACGTCTTTTGCAGATGCTGTTAATGAGCTTGTTTATGATGTACTTATAT
rJMSF011O01+ TCAACGGGTTACGTCTTTTGCAGATGCTGTTAATGAGCTTGTTTATGATGTACTTATAT
rJMFF026F20+ TGCAGATGCTGTTAATGAGCTTGTTTATGATGTACTTATAT
rJMSF012F09+ CTTTTGCAGATGCTGTTAATGAGCTTGTTTATGATGTACTTATAT
rJMFF024I10+ TTTTGCAGATGCTGTTAATGAGCTTGTTTATGATGTACTTATAT
rJMFF030J06+ GTTTATGATGTACTTATAT
rJMSF045B23+ GTTAATGAGCTTGTTTATGATGTACTTATAT
rJMSF024K24+ CAACGGGTTACGTC-TTTGCAGATGCTGTTAATGAGCTTGTTTATGATGTACTTATAT
rJMFF031I22+ CAACGGGTTACGTCTTTTGCAGATGCTGTTAATGAGCTTGTTTATGATGTACTTATAT
                      ____________________________________________________________
consensus CTCAACGGGTTACGTCTTTTGCAGATGCTGTTAATGAGCTTGTTTATGATGTACTTATAT
 
. : . : . : . : . : . :
rJMSF020D16+ CAAAAGTACGACAACACTT-CAATGATTTATCTCGTTTGCCTATATGGTCTTCTGTAGAA
rJMSF011O01+ CAAAAGTACGACAACACTT-CAATGATTTATCTCGTTTGCCTATATGGTCTTCTGTAGAA
rJMFF026F20+ CAAAAGTACGACAACACTTCCAATGATTTATCTCGTTTGCCTATATGGTCTTCTGTAGAA
rJMSF012F09+ CAAAAGTACGACAACACTTCCAATGATTTATCTCGTTTGCCTATATGGTCTTCTGTAGAA
rJMFF024I10+ CAAAAGTACGACAACACTT-CAATGATTTATCTCGTTTGCCTATATGGTCTTCTGTAGAA
rJMFF030J06+ CAAAAGTACGACAACACTT-CAATGATTTATCTCGTTTGCCTATATGGTCTTCTGTAGAA
rJMSF045B23+ CAAAAGTACGACAACACTT-CAATGATTTATCTCGTTTGCCTATATGGTCTTCTGTAGAA
rJMSF024K24+ CAAAAGTACGACAACACTT-CAATGATTTATCTCGTTTGCCTATATGGTCTTCTGTAGAA
rJMFF031I22+ CAAAAGTACGACAACACTT-CAATGATTTATCTCGTTTGCCTATATGGTCTTCTGTAGAA
                      ____________________________________________________________
consensus CAAAAGTACGACAACACTT-CAATGATTTATCTCGTTTGCCTATATGGTCTTCTGTAGAA
 
. : . : . : . : . : . :
rJMSF020D16+ GAGCATAGTGCTCGTCCCCTCCCAACATTCAGTGCATATCCTCAGTCTTATGTTACTAAT
rJMSF011O01+ GAGCATAGTGCTCGTCCCCTCCCAACATTCAGTGCATATCCTCAGTCTTATGTTACTAAT
rJMFF026F20+ GAGCATAGTGCTCGTCCCCTCCCAACATTCAGTGCATATCCTCAGTCTTATGTTACTAAT
rJMSF012F09+ GAGCATAGTGCTCGTCCCCTCCCAACATTCAGTGCATATCCTCAGTCTTATGTTACTAAT
rJMFF024I10+ GAGCATAGTGCTCGTCCCCTCCCAACATTCAGTGCATATCCTCAGTCTTATGTTACTAAT
rJMFF030J06+ GAGCATAGTGCTCGTCCCCTCCCAACATTCAGTGCATATCCTCAGTCTTATGTTACTAAT
rJMSF045B23+ GAGCATAGTGCTCGTCCCCTCCCAACATTCAGTGCATATCCTCAGTCTTATGTTACTAAT
rJMSF024K24+ GAGCATAGTGCTCGTCCCCCCCCAACATTCAGTGCATATCCTCAGTCTTATGTTACTAAT
rJMFF031I22+ GAGCATAGTGCTCGTCCCCTCCCAACATTCAGTGCATATCCTCAGTCTTATGTTACTAAT
                      ____________________________________________________________
consensus GAGCATAGTGCTCGTCCCCTCCCAACATTCAGTGCATATCCTCAGTCTTATGTTACTAAT
 
. : . : . : . : . : . :
rJMSF020D16+ GTTGGTGAGTATCTTCTGACGTTACCCCAACAATTAGAGCCTCTTGCAGAGGGAATTTCC
rJMSF011O01+ GTTGGTGAGTATCTTCTGACGTTACCCCAACAATTAGAGCCTCTTGCAGAGGGAATTTCC
rJMFF026F20+ GTTGGTGAGTATCTTCTGACGTTACCCCAACAATTAGAGCCTCTTGCAGAGGGAATTTCC
rJMSF012F09+ GTTGGTGAGTATCTTCTGACGTTACCCCAACAATTAGAGCCTCTTGCAGAGGGAATTTCC
rJMFF024I10+ GTTGGTGAGTATCTTCTGACGTTACCCCAACAATTAGAGCCTCTTGCAGAGGGAATTTCC
rJMFF030J06+ GTTGGTGAGTATCTTCTGACGTTACCCCAACAATTAGAGCCTCTTGCAGAGGGAATTTCC
rJMSF045B23+ GTTGGTGAGTATCTTCTGACGTTACCCCAACAATTAGAGCCTCTTGCAGAGGGAATTTCC
rJMSF024K24+ GTTGGTGAGTATCTTCTGACGTTACCCCAACAATTAGAGCCTCTTGCAGAGGGAATTTCC
rJMFF031I22+ GTTGGTGAGTATCTTCTGACGTTACCCCAACAATTAGAGCCTCTTGCAGAGGGAATTTCC
                      ____________________________________________________________
consensus GTTGGTGAGTATCTTCTGACGTTACCCCAACAATTAGAGCCTCTTGCAGAGGGAATTTCC
 
. : . : . : . : . : . :
rJMSF020D16+ AATTCTGATGCCAATGCTGATGAGGCCCAGTACTTTGCTACTGAATGGATGTTTAAGGTT
rJMSF011O01+ AATTCTGATGCCAATGCTGATGAGGCCCAGTACTTTGCTACTGAATGGATGTTTAAGGTT
rJMFF026F20+ AATTCTGATGCCAATGCTGATGAGGCCCAGTACTTTGCTACTGAATGGATGTTTAAGGTT
rJMSF012F09+ AATTCTGATGCCAATGCTGATGAGGCCCAGTACTTCGCTACTGAATGGATGTTTAAGGTT
rJMFF024I10+ AATTCTGATGCCAATGCTGATGAGGCCCAGTACTTTGCTACTGAATGGATGTTTAAGGTT
rJMFF030J06+ AATTCTGATGCCAATGCTGATGAGGCCCAGTACTTTGCTACTGAATGGATGTTTAAGGTT
rJMSF045B23+ AATTCTGATGCCAATGCTGATGAGGCCCAGTACTTTGCTACTGAATGGATGTTTAAGGTT
rJMSF024K24+ AATTCTGATGCCAATGCTGATGAGGCCCAGTACTTTGCTACTGAATGGATGTTTAAGGTT
rJMFF031I22+ AATTNTGATGCCAATGCTGATGAGGCCCAGTACTTTGCTACTGAATGGATGTTTAAGGTT
                      ____________________________________________________________
consensus AATTCTGATGCCAATGCTGATGAGGCCCAGTACTTTGCTACTGAATGGATGTTTAAGGTT
 
. : . : . : . : . : . :
rJMSF020D16+ GCAGAAGGTGCTACTGCTCTTTATGTGGATCAATTGCGTGGCATTCAGTATATCACCGAT
rJMSF011O01+ GCAGAAGGTGCTACTGCTCTTTATGTGGATCAATTGCGTGGCATTCAGTATATCACCGAT
rJMFF026F20+ GCAGAAGGTGCTACTGCTCTTTATGTGGATCAATTGCGTGGCATTCAGTATATCACCGAT
rJMSF012F09+ GCAGAAGGTGCTACTGCTCTTTATGTGGATCAATTGCGTGGCATTCAGTATATCACCGAT
rJMFF024I10+ GCAGAAGGTGCTACTGCTCTTTATGTGGATCAATTGCGTGGCATTCAGTATATCACCGAT
rJMFF030J06+ GCAGAAGGTGCTACTGCTCTTTATGTGGATCAATTGCGTGGCATTCAGTATATCACCGAT
rJMSF045B23+ GCAGAAGGTGCTACTGCTCTTTATGTGGATCAATTGCGTGGCATTCAGTATATCACCGAT
rJMSF024K24+ GCAGAAGGTGCTACTGCTCTTTATGTGGATCAATTGCGTGGCATTCAGTATATCACCGAT
rJMFF031I22+ GCAGAAGGTGCTACTGCTCTTTATGTGGATCAATTGCGTGGCATTCAGTATATCACCGAT
                      ____________________________________________________________
consensus GCAGAAGGTGCTACTGCTCTTTATGTGGATCAATTGCGTGGCATTCAGTATATCACCGAT
 
. : . : . : . : . : . :
rJMSF020D16+ CGTGGAGCGCAGCAACTCTCTGTTGATATTGAGTACTTAAGTAATGTGCTTTCAGCTCTA
rJMSF011O01+ CGTGGAGCGCAGCAACTCTCTGTTGATATTGAGTACTTAAGTAATGTGCTTTCAGCTCTA
rJMFF026F20+ CGTGGAGCGCAGCAACTCTCTGTTGATATTGAGTACTTAAGTAATGTGCTTTCAGCTCTA
rJMSF012F09+ CGTGGAGCGCAGCAACTCTCTGTTGATATTGAGTACTTAAGTAATGTGCTTTCAGCTCTA
rJMFF024I10+ CGTGGAGCGCAGCAACTCTCTGTTGATATTGAGTACTTAAGTAATGTGCTTTCAGCTCTA
rJMFF030J06+ CGTGGAGCGCAGCAACTCTCTGTTGATATTGAGTACTTAAGTAATGTGCTTTCAGCTCTA
rJMSF045B23+ CGTGGAGCGCAGCAACTCTCTGTTGATATTGAGTACTTAAGTAATGTGCTTTCAGCTCTA
rJMSF024K24+ CGTGGAGCGCAGCAACTCTCTGTTGATATTGAGTACTTAAGTAATGTGCTTTCAGCTCTA
rJMFF031I22+ CGTGGAGCGCAGCAACTCTCTGTTGATATTGAGTACTTAAGTAATGTGCTTTCAGCTCTA
                      ____________________________________________________________
consensus CGTGGAGCGCAGCAACTCTCTGTTGATATTGAGTACTTAAGTAATGTGCTTTCAGCTCTA
 
. : . : . : . : . : . :
rJMSF020D16+ TCGATGCCCGTTCCTCCAGTTCTTGCCACCTTCCATTCATGTCTCTCAACTCCAAGAAGT
rJMSF011O01+ TCGATGCCCGTTCCTCCAGTTCTTGCCACCTTCCATTCATGTCTCTCAACTCCAAGAAGT
rJMFF026F20+ TCGATGCCCGTTCCTCCAGTTCTTGCCACCTTCCATTCATGTCTCTCAACTCCAAGAAGT
rJMSF012F09+ TCGATGCCCGTTCCTCCAGTTCTTGCCACCTTCCATTCATGTCTCTCAACTCCAAGAAGT
rJMFF024I10+ TCGATGCCCGTTCCTCCAGTTCTTGCCACCTTCCATTCATGTCTCTCAACTCCAAGAAGT
rJMFF030J06+ TCGATGCCCGTTCCTCCAGTTCTTGCCACCTTCCATTCATGTCTCTCAACTCCAAGAAGT
rJMSF045B23+ TCGATGCCCGTTCCTCCAGTTCTTGCCACCTTCCATTCATGTCTCTCAACTCCAAGAAGT
rJMSF024K24+ TCGATGCCCGTTCCTCCAGTTCTTGCCACCTTCCATTCATGTCTCTCAACTCCAAGAAGT
rJMFF031I22+ TCGATGGCCGTTCCTCCAGTTCTTGCCACCTTCCATTCATGTCTCTCAACTCCAAGAAGT
                      ____________________________________________________________
consensus TCGATGCCCGTTCCTCCAGTTCTTGCCACCTTCCATTCATGTCTCTCAACTCCAAGAAGT
 
. : . : . : . : . : . :
rJMSF020D16+ CAGCTCAAGGAACTTGTAAAATCTGATTCTGGAAATCAGCTTGATCTACCCACTGCCAAC
rJMSF011O01+ CAGCTCAAGGAACTTGTAAAATCTGATTCTGGAAATCAGCTTGATCTACCCACTGCCAAC
rJMFF026F20+ CAGCTCAAGGAACTTGTAAAATCTGATTCTGGAAATCAGCTTGATCTACCCACTGCCAAC
rJMSF012F09+ CAGCTCAAGGAACTTGTAAAATCTGATTCTGGAAATCAGCTTGATCTACCCACTGCCAAC
rJMFF024I10+ CAGCTCAAGGAACTTGTAAAATCTGATTCTGGAAATCAGCTTGATCTACCCACTGCCAAC
rJMFF030J06+ CAGCTCAAGGAACTTGTAAAATCTGATTCTGGAAATCAGCTTGATCTACCCACTGCCAAC
rJMSF045B23+ CAGCTCAAGGAACTTGTAAAATCTGATTCTGGAAATCAGCTTGATCTACCCACTGCCAAC
rJMSF024K24+ CAGCTCAAGGAACTTGTAAAATCTGATTCTGGAAATCAGCTTGATCTACCCACTGCCAAC
rJMFF031I22+ CAGCTCAAGGAACTTGTAAAATCTGATTCTGGAAATCAGCTTGATCTACCCACTGCCAAC
                      ____________________________________________________________
consensus CAGCTCAAGGAACTTGTAAAATCTGATTCTGGAAATCAGCTTGATCTACCCACTGCCAAC
 
. : . : . : . : . : . :
rJMSF020D16+ CTTGTGTGCAAAATGCGCCGTGTTAGTTTGGAGTAATGGCACAATGATTGGAGCATTCCT
rJMSF011O01+ CTTGTGTGCAAAATGCGCCGTGTTAGTTTGGAGTAATGGCACAATGATTGGAGCATTCCT
rJMFF026F20+ CTTGTGTGCAAAATGCGCCGTGTTAGTTTGGAGTAATGGCACAATGATTGGAGCATTCCT
rJMSF012F09+ CTTGTGTGCAAAATGCGCCGTGTTAGTTTGGAGTAATGGCACAATGATTGGAGCATTCCT
rJMFF024I10+ CTTGTGTGCAAAATGCGCCGTGTTAGTTTGGAGTAATGGCACAATGATTGGAGCATTCCT
rJMFF030J06+ CTTGTGTGCAAAATGCGCCGTGTTAGTTTGGAGTAATGGCACAATGATTGGAGCATTCCT
rJMSF045B23+ CTTGTGTGCAAAATGCGCCGTGTTAGTTTGGAGTAATGGCACAATGATTGGAGCATTCCT
rJMSF024K24+ CTTGTGTGCAAAATGTGCCGTGTTAGTTTGGAGTAATGGCACAATGATTGGAGCATTCCT
rJMFF031I22+ CTTGTGTGCAAAATGCGCCGTGTTAGTTTGGAGTAATGGCACAATGATTGGAGCATTCCT
                      ____________________________________________________________
consensus CTTGTGTGCAAAATGCGCCGTGTTAGTTTGGAGTAATGGCACAATGATTGGAGCATTCCT
 
. : . : . : . : . : . :
rJMSF020D16+ ACTGTTCAGAGACCCTGTAAGGTTCACCCTTTCTGGGCCAGTATACTTCGTTGGGTGTGT
rJMSF011O01+ ACTGTTCAGAGACCCTGTAAGGTTCACCCTTTCTGGGCCAGTATACTTCGTTGGGTGTGT
rJMFF026F20+ ACTGTTCAGAGACCCTGTAAGGTTCACCCTTTCTGGGCCAGTATACTTCGTTGGGTGTGT
rJMSF012F09+ ACTGTTCAGAGACCCTGTAAGGTTCACCCTTTCTGGGCCAGTATACTTCGTTGGGTGTGT
rJMFF024I10+ ACTGTTCAGAGACCCTGTAAGGTTCACCCTTTCTGGGCCAGTATACTTCGTTGGGTGTGT
rJMFF030J06+ ACTGTTCAGAGACCCTGTAAGGTTCACCCTTTCTGGGCCAGTATACTTCGTTGGGTGTGT
rJMSF045B23+ ACTGTTCAGAGACCCTGTAAGGTTCACCCTTTCTGGGCCAGTATACTTCGTTGGGTGTGT
rJMSF024K24+ ACTGTTCAGAGACCCTGTAAGGTTCACCCTTTCTGGGCCAGTATACTTCGTTGGGTGTGT
rJMFF031I22+ ACTGTTC--ATACCCTGTAAGGTTCACCCTTTCTGGGCCAGTATACTTCGTTGGGTGTGT
                      ____________________________________________________________
consensus ACTGTTCAGAGACCCTGTAAGGTTCACCCTTTCTGGGCCAGTATACTTCGTTGGGTGTGT
 
. : . : . : . : . : . :
rJMSF020D16+ GGTTTAAGAATTATGTTACCCCGTATCATATTCTGCTTGTGCTGGGGAAAAAGGGAGGAT
rJMSF011O01+ GGTTTAAGAATTATGTTACCCCGTATCATATTCTGCTTGTGCTGGGGAAAAAGGGAGGAT
rJMFF026F20+ GGTTTAAGAATTATGTTACCCCGTATCATATTCTGCTTGTGCTGGGGAAAAAGGGAGGAT
rJMSF012F09+ GGTTTAAGAATTATGTTACCCCGTATCATATTCTGCTTGTGCTGGGGAAAAAGGGAGGAT
rJMFF024I10+ GGTTTAAGAATTATGTTACCCCGTATCATATTCTGCTTGTGCTGGGGAAAAAGGGAGGAT
rJMFF030J06+ GGTTTAAGAATTATGTTACCCCGTATCATATTCTGCTTGTGCTGGGGAAAAAGGGAGGAT
rJMSF045B23+ GGTTTAAGAATTATGTTACCCCGTATCATATTCTGCTTGTGCTGGGGAAAAAGGGAGGAT
rJMSF024K24+ GGTTTAAGAATTATGTTACCCCGTATCATATTCTGCTTGTGCTGGGGAAAAAGGGAGGAT
rJMFF031I22+ GGTTTAAGAATTATGTTACCACGTATCATATTCTGCTTGTGCTGGGGAAAAAGGGAGGAT
                      ____________________________________________________________
consensus GGTTTAAGAATTATGTTACCCCGTATCATATTCTGCTTGTGCTGGGGAAAAAGGGAGGAT
 
. : . : . : . : . : . :
rJMSF020D16+ AGGCTGGAATTTTTTTTTCCCCAATCCATGCATTTT
rJMSF011O01+ AGGCTGGAATTTTTTTTTCCCCAAT-CATGCATTTT
rJMFF026F20+ AGGCTGGAATTTTTTTTTCCCCAAT-CATGCATTTTTGTTGTACTATACGAAATTG
rJMSF012F09+ AGGCTGGAA-TTTTTTTTCCCCAAT-CATGCATTTTTGTTGTACTATACGAAATTG
rJMFF024I10+ AGGCTGGAATTTTTTTTTCCCCAAT-CATGCATTTTTGTTGTACT
rJMFF030J06+ AGGCTGGAATTTTTTTTTCCCCAAT-CATGCATTTTTGTTGTACTA
rJMSF045B23+ AGGCTGGAATTTTTTTTTCCCCAAT-CATGCATTTTTGTTGTACTATA
rJMSF024K24+ AGGCTGGAATTTTTTTTTCCCCAAT-CATGCATTTTTGTTGTACTATACGAAATTG
rJMFF031I22+ AGGCTGGAATTTTTTTTTCCCCAAT-CATGCATTTTTGTTGTACTATACGAAATTGGTGT
                      ____________________________________________________________
consensus AGGCTGGAATTTTTTTTTCCCCAAT-CATGCATTTTTGTTGTACTATACGAAATTGGTGT