Previous Contig 009670:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031F13Sequence569009670 (4)gb:AY070742_15668921e-70Arabidopsis thaliana AT3g22845/MWI23_22 mRNA, complete cds.>gb:AY093742_1575402 683009670 (4)gb:AY070742_15668927e-71Arabidopsis thaliana AT3g22845/MWI23_22 mRNA, complete cds.>gb:AY093742_1575402
JMSF020A20Sequence711009670 (4)gb:AY070742_15668924e-98Arabidopsis thaliana AT3g22845/MWI23_22 mRNA, complete cds.>gb:AY093742_1575402 721009670 (4)gb:AY070742_15668927e-80Arabidopsis thaliana AT3g22845/MWI23_22 mRNA, complete cds.>gb:AY093742_1575402

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF031F13- TCTGCTACAATT
                      ____________________________________________________________
consensus TCTGCTACAATT
 
. : . : . : . : . : . :
JMFF031F13- CTTCAATCTCATTTACCCAAAAACAGCCATTCAGAAAGCAATCCGGCGAAGAAAAGCTGT
                      ____________________________________________________________
consensus CTTCAATCTCATTTACCCAAAAACAGCCATTCAGAAAGCAATCCGGCGAAGAAAAGCTGT
 
. : . : . : . : . : . :
JMFF031F13- GAATTTTTTTTGAAAATGGAAATCACCGCGGGAATCAGAGCCTATGCGCTGTTGTTGATG
JMSF020A20- GCGGGAATCAGAGCCTATGCGCTGTTGTTGATG
                      ____________________________________________________________
consensus GAATTTTTTTTGAAAATGGAAATCACCGCGGGAATCAGAGCCTATGCGCTGTTGTTGATG
 
. : . : . : . : . : . :
JMFF031F13- ATGCTGTTCAGTTTCGTCACCAATCTCTCCGCGCTATCTGTTACCGTCAACGATGTCGAA
JMSF020A20- ATGCTGTTCAGTTTCGTCACCAATCTCTCCGCGCTATCTGTTACCGTCAACGATGTCGAA
                      ____________________________________________________________
consensus ATGCTGTTCAGTTTCGTCACCAATCTCTCCGCGCTATCTGTTACCGTCAACGATGTCGAA
 
. : . : . : . : . : . :
JMFF031F13- TGCGTGTACGAGTACGTTCTGTACGAAGGCGACACCATTTCCGGCAACTTCGTCGTTGTC
JMSF020A20- TGCGTGTACGAGTACGTTCTGTACGAAGGCGACACCATTTCCGGCAACTTCGTCGTTGTC
rJMSF020A20+ TTGTC
                      ____________________________________________________________
consensus TGCGTGTACGAGTACGTTCTGTACGAAGGCGACACCATTTCCGGCAACTTCGTCGTTGTC
 
. : . : . : . : . : . :
JMFF031F13- GATCACGACATCTTCTGGAACTCGGATCACCCTGGCATTGATTTCACTGTGACATCACCT
JMSF020A20- GATCACGACATCTTCTGGAACTCGGATCACCCTGGCATTGATTTCACTGTGACATCACCT
rJMSF020A20+ GATCACGACATCTTCTGGAACTCGGATCACCCTGGCATTGATTTCACTGTGACATCACCT
rJMFF031F13+ TTGATTTCACTGTGACATCACCT
                      ____________________________________________________________
consensus GATCACGACATCTTCTGGAACTCGGATCACCCTGGCATTGATTTCACTGTGACATCACCT
 
. : . : . : . : . : . :
JMFF031F13- GGAGACAATGTTGTCCACTCAATGAAGGGAACATCTGGTGACAAATTTGATTTTAAAGCC
JMSF020A20- GGAGACAATGTTGTCCACTCAATGAAGGGAACATCTGGTGACAAATTTGATTTTAAAGCC
rJMSF020A20+ GGAGACAATGTTGTCCACTCAATGAAGGGAACATCTGGTGACAAATTTGATTTTAAAGCC
rJMFF031F13+ GGAGACAATGTTGTCCACTCAATGAAGGGAACATCTGGTGACAAATTTGATTTTAAAGCC
                      ____________________________________________________________
consensus GGAGACAATGTTGTCCACTCAATGAAGGGAACATCTGGTGACAAATTTGATTTTAAAGCC
 
. : . : . : . : . : . :
JMFF031F13- CCAAGAAGTGGGATGTACAAATTCTGTTTTCACAACCCATATTCAACACCAGAAACAGTC
JMSF020A20- CCAAGAAGTGGGATGTACAAATTCTGTTTTCACAACCCATATTCAACACCAGAAACAGTC
rJMSF020A20+ CCAAGAAGTGGGATGTACAAATTCTGTTTTCACAACCCATATTCAACACCAGAAACAGTC
rJMFF031F13+ CCAAGAAGTGGGATGTACAAATTCTGTTTTCACAACCCATATTCAACACCAGAAACAGTC
                      ____________________________________________________________
consensus CCAAGAAGTGGGATGTACAAATTCTGTTTTCACAACCCATATTCAACACCAGAAACAGTC
 
. : . : . : . : . : . :
JMFF031F13- TCCTTCTACATACATGTTGGCCACATTCCTAATGAGCATAACCTTGCCAAGGATGAACAC
JMSF020A20- TCCTTCTACATACATGTTGGCCACATTCCTAATGAGCATAACCTTGCCAAGGATGAACAC
rJMSF020A20+ TCCTTCTACATACATGTTGGCCACATTCCTAATGAGCATAACCTTGCCAAGGATGAACAC
rJMFF031F13+ TCCTTCTACATACATGTTGGCCACATTCCTAATGAGCATAACCTTGCCAAGGATGAACAC
                      ____________________________________________________________
consensus TCCTTCTACATACATGTTGGCCACATTCCTAATGAGCATAACCTTGCCAAGGATGAACAC
 
. : . : . : . : . : . :
JMFF031F13- TTGGATCCCATTAATGTTAAAATTGCTGAACTGAGGGAGGCATTGGAATCCGTTACATCT
JMSF020A20- TTGGATCCCATTAATGTTAAAATTGCTGAACTGAGGGAGGCATTGGAATCCGTTACATCT
rJMSF020A20+ TTGGATCCCATTAATGTTAAAATTGCTGAACTGAGGGAGGCATTGGAATCCGTTACATCT
rJMFF031F13+ TTGGATCCCATTAATGTTAAAATTGCTGAACTGAGGGAGGCATTGGAATCCGTTACATCT
                      ____________________________________________________________
consensus TTGGATCCCATTAATGTTAAAATTGCTGAACTGAGGGAGGCATTGGAATCCGTTACATCT
 
. : . : . : . : . : . :
JMFF031F13- GAGCAGAAGTATTTGAA
JMSF020A20- GAGCAGAAGTATTTGAAGGCACGGGATGCCCGCCATCGTCATACAAATGAGAGCACAAGA
rJMSF020A20+ GAGCAGAAGTATTTGAAGGCACGGGATGCCCGCCATCGTCATACAAATGAGAGCACAAGA
rJMFF031F13+ GAGCAGAAGTATTTGAAGGCACGGGATGCCCGCCATCGTCATACAAATGAGAGCACAAGA
                      ____________________________________________________________
consensus GAGCAGAAGTATTTGAAGGCACGGGATGCCCGCCATCGTCATACAAATGAGAGCACAAGA
 
. : . : . : . : . : . :
JMSF020A20- AAGCGAGTCATTTTCTACACAGTTGGAGAGTATATTTTGCTTGCTCTTGCTAGTTCACTT
rJMSF020A20+ AAGCGAGTCATTTTCTACACAGTTGGAGAGTATATTTTGCTTGCTCTTGCTAGTTCACTT
rJMFF031F13+ AAGCGAGTCATTTTCTACACAGTTGGAGAGTATATTTTGCTTGCTCTTGCTAGTTCACTT
                      ____________________________________________________________
consensus AAGCGAGTCATTTTCTACACAGTTGGAGAGTATATTTTGCTTGCTCTTGCTAGTTCACTT
 
. : . : . : . : . : . :
JMSF020A20- CAAGTTGTTTACATCCGCCGCTTGTTCAGCAAGTCAGTAGCCTACAACCGGGTTTGACCA
rJMSF020A20+ CAAGTTGTTTACATCCGCCGCTTGTTCAGCAAGTCAGTAGCCTACAACCGGGTTTGACCA
rJMFF031F13+ CAAGTTGTTTACATCCGCCGCTTGTTCAGCAAGTCAGTAGCCTACAACCGGGTTTGACCA
                      ____________________________________________________________
consensus CAAGTTGTTTACATCCGCCGCTTGTTCAGCAAGTCAGTAGCCTACAACCGGGTTTGACCA
 
. : . : . : . : . : . :
JMSF020A20- AGTTGCATGCTTGTAGTTTCCTCATCCTTTTTACAGGAATTATATTGCTGTTTACTATCA
rJMSF020A20+ AGTTGCATGCTTGTAGTTTCCTCATCCTTTTTACAGGAATTATATTGCTGTTTACTATCA
rJMFF031F13+ AGTTGCATGCTTGTAGTTTCCTCATCCTTTTTACAGGAATTATATTGCTGTTTACTATCA
                      ____________________________________________________________
consensus AGTTGCATGCTTGTAGTTTCCTCATCCTTTTTACAGGAATTATATTGCTGTTTACTATCA
 
. : . : . : . : . : . :
JMSF020A20- CTGTCAGTTCATTTA
rJMSF020A20+ CTGTCAGTTCATTTAGAGGAAAAAACAACACTTCCCTGAAACAAAAATAACATTATAATT
rJMFF031F13+ CTGTCAGTTCATTTAGAGGAAAAAACAACACTTCCCTGAAACAAAAATAACATTATAATT
                      ____________________________________________________________
consensus CTGTCAGTTCATTTAGAGGAAAAAACAACACTTCCCTGAAACAAAAATAACATTATAATT
 
. : . : . : . : . : . :
rJMSF020A20+ ACTTGTTAAATTTATCATCAACATTTTAGGATTGTGCATTTGTGCGTGTAATGTCATCTT
rJMFF031F13+ ACTTGTTAAATTTATCATCAACATTTTAGGATTGTGCATTTGTGCATGTAATGTCATCTT
                      ____________________________________________________________
consensus ACTTGTTAAATTTATCATCAACATTTTAGGATTGTGCATTTGTGCGTGTAATGTCATCTT
 
. : . : . : . : . : . :
rJMSF020A20+ CTGTTACTTAAGACTCACCTGCATGTAGTAGCAATTTGTGCCCCAGAAGGGGTGAT
rJMFF031F13+ ATGTTACTTAAGACTCACCTGCATGTAGTAGCAATTTGTGCCCCAGAAGGGGTGATTAAG
                      ____________________________________________________________
consensus CTGTTACTTAAGACTCACCTGCATGTAGTAGCAATTTGTGCCCCAGAAGGGGTGATTAAG