Previous Contig 009666:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031E11Sequence562009666 (6)gb:AP003143_18249041e-70Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P048431009666 (6)sp|Q8LEK2|FA18_ARATH5e-19FAM18-like protein At1g09330.>gb:AY085379_1570449 Arabidopsis thaliana clone 148
JMSF019P10Sequence321009666 (6)gb:AP003143_18249043e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P048718009666 (6)sp|Q8LEK2|FA18_ARATH4e-81FAM18-like protein At1g09330.>gb:AY085379_1570449 Arabidopsis thaliana clone 148
JMSF020E10Sequence673009666 (6)sp|Q8LEK2|FA18_ARATH1e-81FAM18-like protein At1g09330.>gb:AY085379_1570449 Arabidopsis thaliana clone 148728009666 (6)sp|Q8LEK2|FA18_ARATH1e-81FAM18-like protein At1g09330.>gb:AY085379_1570449 Arabidopsis thaliana clone 148

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF019P10- GACCAGAAATATCAATTTTATAAACTCGGGAGTTGAATCCGAGA
JMFF031E11- AGAAATATCAATTTTATAAACTCGGGAGTTGAATCCGAGA
JMSF020E10- AGAAATATCAATTTTATAAACTCGGGAGTTGAATCCGAGA
                      ____________________________________________________________
consensus GACCAGAAATATCAATTTTATAAACTCGGGAGTTGAATCCGAGA
 
. : . : . : . : . : . :
JMSF019P10- AGAGACGCAGAAGAGAAGATCACACAGCTGAGGGGAGGTACTGAAAATCCCTGCATTTGA
JMFF031E11- AGAGACGCAGAAGAGAAGATCACACAGCTGAGGGGAGGTACTGAAAATCCCTGCATTTGA
JMSF020E10- AGAGACGCAGAAGAGAAGATCACACAGCTGAGGGGAGGTACTGAAAATCCCTGCATTTGA
                      ____________________________________________________________
consensus AGAGACGCAGAAGAGAAGATCACACAGCTGAGGGGAGGTACTGAAAATCCCTGCATTTGA
 
. : . : . : . : . : . :
JMSF019P10- ATTATCCAAAAAATGGATCTGAATCCTCCTGCAGGGGAGAACTATGCAAACCCTAATATA
JMFF031E11- ATTATCCAAAAAATGGATCTGAATCCTCCTGCAGGGGAGAACTATGCAAACCCTAATATA
JMSF020E10- ATTATCCAAAAAATGGATCTGAATCCTCCTGCAGGGGAGAACTATGCAAACCCTAATATA
rJMSF019P10+ GAACTATGCAAACCCTAATATA
rJMSF020E10+ TGCAGGGGAGAACTATGCAAACCCTAATATA
                      ____________________________________________________________
consensus ATTATCCAAAAAATGGATCTGAATCCTCCTGCAGGGGAGAACTATGCAAACCCTAATATA
 
. : . : . : . : . : . :
JMSF019P10- TGTTTCTTCCATGTGCTCTTCAAGGCAGCAGCTTTGGCATTTTACATACTTTCAGCTCTA
JMFF031E11- TGTTTCTTCCATGTGCTCTTCAAGGCAGCAGCTTTGGCATTTTACATACTTTCAGCTCTA
JMSF020E10- TGTTTCTTCCATGTGCTCTTCAAGGCAGCAGCTTTGGCATTTTACATACTTTCAGCTCTA
rJMSF019P10+ TGTTTCTTCCATGTGCTCTTCAAGGCAGCAGCTTTGGCATTTTACATACTTTCAGCTCTA
rJMSF020E10+ TGTTTCTTCCATGTGCTCTTCAAGGCAGCAGCTTTGGCATTTTACATACTTTCAGCTCTA
                      ____________________________________________________________
consensus TGTTTCTTCCATGTGCTCTTCAAGGCAGCAGCTTTGGCATTTTACATACTTTCAGCTCTA
 
. : . : . : . : . : . :
JMSF019P10- TTTGTCGATAGTTTTGTTATCATATTTGTGGTCACTGTTCTGCTAGCAGCTCTTGACTTT
JMFF031E11- TTTGTCGATAGTTTTGTTATCATATTTGTGGTCACTGTTCTGCTAGCAGCTCTTGACTTT
JMSF020E10- TTTGTCGATAGTTTTGTTATCATATTCGTGGTCACTGTTCTGCTAGCAGCTCTTGACTTT
rJMSF019P10+ TTTGTCGATAGTTTTGTTATCATATTTGTGGTCACTGTTCTGCTAGCAGCTCTTGACTTT
rJMSF020E10+ TTTGTCGATAGTTTTGTTATCATATTCGTGGTCACTGTTCTGCTAGCAGCTCTTGACTTT
                      ____________________________________________________________
consensus TTTGTCGATAGTTTTGTTATCATATTTGTGGTCACTGTTCTGCTAGCAGCTCTTGACTTT
 
. : . : . : . : . : . :
JMSF019P10- TGGGTTGTTAAGAATGTGAGTGGACGCATCTTAGTGG
JMFF031E11- TGGGTTGTTAAGAATGTGAGTGGACGCATCTTAGTGGGTTTGAGGTGGTGGAATGAAATA
JMSF020E10- TGGGTTGTTAAGAATGTGAGTGGACGCATCTTAGTGGGTTTGAGGTGGTGGAATGAAATA
rJMSF019P10+ TGGGTTGTTAAGAATGTGAGTGGACGCATCTTAGTGGGTTTGAGGTGGTGGAATGAAATA
rJMSF020E10+ TGGGTTGTTAAGAATGTGAGTGGACGCATCTTAGTGGGTTTGAGGTGGTGGAATGAAATA
                      ____________________________________________________________
consensus TGGGTTGTTAAGAATGTGAGTGGACGCATCTTAGTGGGTTTGAGGTGGTGGAATGAAATA
 
. : . : . : . : . : . :
JMFF031E11- AGTGAAGAGGGTGAAAGTTTGTGGAAATTTGAGTGCCTTGACCAAGAGTCGTTGGCTCGC
JMSF020E10- AGTGAAGAGGGTGAAAGTTTGTGGAAATTTGAGTGCCTTGACCAAGAGTCGTTGGCTCGC
rJMSF019P10+ AGTGAAGAGGGTGAAAGTTTGTGGAAATTTGAGTGCCTTGACCAAGAGTCGTTGGCTCGC
rJMSF020E10+ AGTGAAGAGGGTGAAAGTTTGTGGAAATTTGAGTGCCTTGACCAAGAGTCGTTGGCTCGC
                      ____________________________________________________________
consensus AGTGAAGAGGGTGAAAGTTTGTGGAAATTTGAGTGCCTTGACCAAGAGTCGTTGGCTCGC
 
. : . : . : . : . : . :
JMFF031E11- ATGAATAAGAAGGATTCTTGGCTTTTCTGGTGGACACTATACCTTACTGCTGTGGCTTGG
JMSF020E10- ATGAATAAGAAGGATTCTTGGCTTTTCTGGTGGACACTATACCTTACTGCTGTGGCTTGG
rJMSF019P10+ ATGAATAAGAAGGATTCTTGGCTTTTCTGGTGGACACTATACCTTACTGCTGTGGCTTGG
rJMSF020E10+ ATGAATAAGAAGGATTCTTGGCTTTTCTGGTGGACACTATACCTTACTGCTGTGGCTTGG
rJMFF031E11+ GTGGCTCGG
                      ____________________________________________________________
consensus ATGAATAAGAAGGATTCTTGGCTTTTCTGGTGGACACTATACCTTACTGCTGTGGCTTGG
 
. : . : . : . : . : . :
JMFF031E11- ATTATTCTCGGAATATTCTCACTCATTANATTCCAAGCTGACTATCTCCTTGTTATTGGT
JMSF020E10- ATTATTCTCGGAATATTCTCACTCATTAGATTCCAAGCTGACTATCTCCTTGTTATTGGT
rJMSF019P10+ ATTATTCTCGGAATATTCTCACTCATTAGATTCCAAGCTGACTATCTCCTTGTTATTGGT
rJMSF020E10+ ATTATTCTCGGAATATTCTCACTCATTAGATTCCAAGCTGACTATCTCCTTGTTATTGGT
rJMFF031E11+ ATTATTCTCGGAATATTCTCACTCATTAGATTCCAAGNTGANTATCTCCTTGTTATTGGT
                      ____________________________________________________________
consensus ATTATTCTCGGAATATTCTCACTCATTAGATTCCAAGCTGACTATCTCCTTGTTATTGGT
 
. : . : . : . : . : . :
JMFF031E11- GTGTGCTTGACACTCAGCATTGCAAATATTGTTGGCTTTACT
JMSF020E10- GTGTGCTTGACACTCAGCATTGCAAATATTGTTGGCTTTACTAGGTGCCGCAAAGATGCC
rJMSF019P10+ GTGTGCTTGACACTCAGCATTGCAAATATTGTTGGCTTTACTAGGTGCCGCAAAGATGCC
rJMSF020E10+ GTGTGCTTGACACTCAGCATTGCAAATATTGTTGGCTTTACTAGGTGCCGCAAAGATGCC
rJMFF031E11+ GTGTGCTTGNCACTCAGCATTGCAAATATTGTTGGCTTTACTAGGTGCCGCAAAGATGCC
                      ____________________________________________________________
consensus GTGTGCTTGACACTCAGCATTGCAAATATTGTTGGCTTTACTAGGTGCCGCAAAGATGCC
 
. : . : . : . : . : . :
JMSF020E10- AAGAAGCAGCTTCAAGCATTTGCCACTCAGACCCTCGCATCACGAGTATCTTCTACCATC
rJMSF019P10+ AAGAAGCAGCTTCAAGCATTTGCCACTCAGACCCTCGCATCACGAGTATCTTCTACCATC
rJMSF020E10+ AAGAAGCAGCTTCAAGCATTTGCCACTCAGACCCTCGCATCACGAGTATCTTCTACCATC
rJMFF031E11+ AAGAAGCAGCTTCAAGCATTTGCCACTCAGACCCTCGCATCANGAGTATCTTNTACCATC
                      ____________________________________________________________
consensus AAGAAGCAGCTTCAAGCATTTGCCACTCAGACCCTCGCATCACGAGTATCTTCTACCATC
 
. : . : . : . : . : . :
JMSF020E10- CAGACTGCATTCAGTGTTGTTTGAACTC
rJMSF019P10+ CAGACTGCATTCAGTGTTGTTTGAACTCCTACAAGGAAGAGGTGAACTGGGCACAAAAGA
rJMSF020E10+ CAGACTGCATTCAGTGTTGTTTGAACTCCTACAAGGAAGAGGTGAACTGGGCACAAAAGA
rJMFF031E11+ CAGATTGCANTCAGTGTTGTTTGAACTCNTACAAGGAAGAGGNGAACTGGGCACAAAAGA
                      ____________________________________________________________
consensus CAGACTGCATTCAGTGTTGTTTGAACTCCTACAAGGAAGAGGTGAACTGGGCACAAAAGA
 
. : . : . : . : . : . :
rJMSF019P10+ ATCAATTCGTGAATGTCAGCCAACTTACACACTTGCATGTCACTGTATTGGAATGTCAAC
rJMSF020E10+ ATCAATTCGTGAATGTCAGCCAACTTACACACTTGCATGTCACTGTATTGGAATGTCAAC
rJMFF031E11+ ATCAATTCGTGAATGTCAGCCAACTTACACACTTGCATGTCACTGTATTGGAATGTCAAC
                      ____________________________________________________________
consensus ATCAATTCGTGAATGTCAGCCAACTTACACACTTGCATGTCACTGTATTGGAATGTCAAC
 
. : . : . : . : . : . :
rJMSF019P10+ AGCTTTTTCTTTTACAGTTTTGTAGAGATGATGGAACAATGGATAGGCGTTTGTATTATT
rJMSF020E10+ AGCTTTTTCTTTTACAGTTTTGTAGAGATGATGGAACAATGGATAGGCGTTTGTATTATT
rJMFF031E11+ AGCTTTTTCTTTTACAGTTTTGTAGAGATGATGGAACAATGGATAGGCGTNTGTATTATT
                      ____________________________________________________________
consensus AGCTTTTTCTTTTACAGTTTTGTAGAGATGATGGAACAATGGATAGGCGTTTGTATTATT
 
. : . : . : . : . : . :
rJMSF019P10+ CTTTGACTACTATAGGTCCAGTGCATGT
rJMSF020E10+ CTTTGACTACTATAGGTCCAGTGCATGT-GAACGAAC
rJMFF031E11+ CTTNGACTACTATAGGTCCAGTGCATGTNGAACGAACATACAAATAAGTTTGGAAAAAAT
                      ____________________________________________________________
consensus CTTTGACTACTATAGGTCCAGTGCATGTNGAACGAACATACAAATAAGTTTGGAAAAAAT