Previous Contig 009665:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031E05Sequence540007642 (5)gb:AP003199_18250238e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B104737009665 (4)gb:AC123513_11924101e-40Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN
JMSF013J05Sequence577007642 (5)gb:AP003199_18250233e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B104689009665 (4)gb:AC123513_11924109e-41Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN
JMSF045A11Sequence638007642 (5)gb:AP005723_18565717e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN587009665 (4)gb:AC123513_11924107e-41Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN
JMSF046K20Sequence736007642 (5)gb:AP003199_18250233e-36Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B104647009665 (4)gb:AC009465_15367771e-05Arabidopsis thaliana chromosome 3 BAC T9J14 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF031E05+ GTGTTTTTCAGAGAACAAGCCAGGGTGAG
                      ____________________________________________________________
consensus GTGTTTTTCAGAGAACAAGCCAGGGTGAG
 
. : . : . : . : . : . :
rJMSF013J05+ TCATCATCATCA-TTTTAATAAAGCACAATGAGCTTTACAGGTTCTCCCAT
rJMSF046K20+ TTACAGTTTCTCCCAT
rJMFF031E05+ TCTGATTCATCATCATCATCATTTTTAATAAAGCACAATGAGCTTTACAGNTTCTCCCAT
                      ____________________________________________________________
consensus TCTGATTCATCATCATCATCATTTTTAATAAAGCACAATGAGCTTTACAGTTTCTCCCAT
 
. : . : . : . : . : . :
rJMSF013J05+ AAAATTCCGTCATTCAGATTGACTGGAACTGAAAGAGAAGGTGTGCCTGAGGGATCTTTT
rJMSF045A11+ GGGATCTTTT
rJMSF046K20+ AGAATTCCCTCATTCACATTGACTGGAACTGAAAGAGAAGGTGTGCCTGAGGGATCTTTT
rJMFF031E05+ AAAATTCCGTCATTCAGATTGACTGGAACTGAAAGAGAAGGTGTGCCTGAGGGATCTTTT
                      ____________________________________________________________
consensus AAAATTCCGTCATTCAGATTGACTGGAACTGAAAGAGAAGGTGTGCCTGAGGGATCTTTT
 
. : . : . : . : . : . :
rJMSF013J05+ GAACTTGATCTTGCTTCTATACCTCAAGATCCTAATGACCTTTGGTATCCTCTGAAAGAG
rJMSF045A11+ GAACTTGATCTTGCTTCTATACCTCAAGATCCTAATGACCTTTGGTATCCTCTGAAAGAG
rJMSF046K20+ GAACNTGATCTTGCTTCTATACCTCAAGATCCTAATGACCTTTGGTATCCTCTGAAAGAG
rJMFF031E05+ GAACTTGATCTTGCTTCTATACCTCAAGATCCTAATGACCTTTGGTATCCTCTGAAAGAG
                      ____________________________________________________________
consensus GAACTTGATCTTGCTTCTATACCTCAAGATCCTAATGACCTTTGGTATCCTCTGAAAGAG
 
. : . : . : . : . : . :
rJMSF013J05+ GCGATCAGAAATGTTGAACCAGAACTGAAGAGGCCCGGCAAAAATGGTAAAACAATGCCA
rJMSF045A11+ GCGATCAGAAATGTTGAACCAGAACTGAAGAGGCCCGGCAAAAATGGTAAAACAATGCCA
rJMSF046K20+ GCAAACAGAAATGGTGAACCAGAACTGAAGAGTCCCNGAAGAAACGGTAAAACCNGGATA
rJMFF031E05+ GCGATCAGAAATGTTGAACCAGAACTGAAGAGGCCCGGCAAAAATGGTAAAACAATGCCA
                      ____________________________________________________________
consensus GCGATCAGAAATGTTGAACCAGAACTGAAGAGGCCCGGCAAAAATGGTAAAACAATGCCA
 
. : . : . : . : . : . :
rJMSF013J05+ CCCAAGAAGGTTGGCACACCTAACAAGTCCACTGATTGCAAAGAGGTGAGTGATAGTGAT
rJMSF045A11+ CCCAAGAAGGTTGGCACACCTAACAAGTCCACTGATTGCAAAGAGGTGAGTGATAGTGAT
rJMSF046K20+ CCCAAGAAGGTTAGTACACCTAACAAGTCCNCTGATTGGAAAGAGGTGAGTGATGGTGAT
rJMFF031E05+ CCCAAGAAGGTTGGCACACCTAACAAGTCCACTGATTGCAAAGAGGTGAGTGATAGTGAT
                      ____________________________________________________________
consensus CCCAAGAAGGTTGGCACACCTAACAAGTCCACTGATTGCAAAGAGGTGAGTGATAGTGAT
 
. : . : . : . : . : . :
rJMSF013J05+ GGTGATGGAGAGATGTGTATGCTTCGAAAGTCACCAAGGGCTTCCAAGAAAAGAT---AG
rJMSF045A11+ GGTGATGGAGAGATGTGTATGCTTCGAAAGTCACCAAGGGCTTCCAAGAAAAGAT---AG
rJMSF046K20+ GGTGAGGGTGAGATGCCTAAGCTTCGAAAGTCGCCAAGGGCTGCCAAGAAAAGATAAAAG
rJMFF031E05+ GGTGATGGAGAGATGTGTATGCTTCGAAAGTCACCAAGGGCTTCCAAGAAAAGAT---AG
                      ____________________________________________________________
consensus GGTGATGGAGAGATGTGTATGCTTCGAAAGTCACCAAGGGCTTCCAAGAAAAGAT---AG
 
. : . : . : . : . : . :
rJMSF013J05+ AAAA------CCGATCAATTCTATTCCATTGCTCTCTGAACTAAAAGATAGTACTAGGGA
rJMSF045A11+ AAAA------CCGATCAATTCTATTCCATTGCTCTCTGAACTAAAAGATAGTACTAGGGA
rJMSF046K20+ AAAAAAAAACCCGATCAATTCTATTCCATTGCTCTCTAAACTAAAAGATAGTACTAGGGA
rJMFF031E05+ AAAA------CCGATCAATTCTATTCCATTGCTCTCTGAACTAAAAGATAGTACTAGGGA
                      ____________________________________________________________
consensus AAAA------CCGATCAATTCTATTCCATTGCTCTCTGAACTAAAAGATAGTACTAGGGA
 
. : . : . : . : . : . :
rJMSF013J05+ CCAGTGCGGTAGCAGTGCTGAAAGATTCTAACTTTTAGTGATTGGTGATGGTGATGGTGG
rJMSF045A11+ CCAGTGCGGTAGCAGTGCTGAAAGATTCTAACTTTTAGTGATTGGTGATGGTGATGGTGG
rJMSF046K20+ CCAGTGCAGTAGCAGTGCTGAAAGATTCTAACTTTTAGTGATTGGTGATGGTGATGGTGG
rJMFF031E05+ CCAGTGCGGTAGCAGTGCTGAAAGATTCTAACTTTTAGTGATTGGTGATGGTGATGGTGG
                      ____________________________________________________________
consensus CCAGTGCGGTAGCAGTGCTGAAAGATTCTAACTTTTAGTGATTGGTGATGGTGATGGTGG
 
. : . : . : . : . : . :
rJMSF013J05+ ATTGGTGGTGGTAAGAGTTTGAAGTTTTTCAACCTTCTTCCTCTCTTCAGTCATCATCCC
rJMSF045A11+ ATTGGTGGTGGTAAGAGTTTGAAGTTTTTCAACCTTCTTCCTCTCTTCAGTCATCATCCC
rJMSF046K20+ ATTGGTGGTGGTAAGAGTTCGAAGTTTTTCGACCTTTTTCCTCTCTTCAGTCATCATCCC
rJMFF031E05+ ATTGGTGGTGGTAAGAGTTTGAAGTTTTTCAACCTTCTTCCTCTCTTCAGTCATCATCCC
                      ____________________________________________________________
consensus ATTGGTGGTGGTAAGAGTTTGAAGTTTTTCAACCTTCTTCCTCTCTTCAGTCATCATCCC
 
. : . : . : . : . : . :
rJMSF013J05+ TGTGAAATATGTTATGTTATTTGGAGGCCAAGTGAATGGTTAACAGATTGAATTGGTAGG
rJMSF045A11+ TGTGAAATATGTTATGTTATTTGGAGGCCAAGTGAATGGTTAACAGATTGAATTGGTAGG
rJMSF046K20+ TGTGAAATATGTTGTGTTATGTGGAGGCCAAGTGAATGTTTAACAGATTGAATTGGTAGG
rJMFF031E05+ TGTGAAATATGTTATGTTATTTGGAGGCCAAGTGAATGGTTAACAGATTGAATTGGTAGG
                      ____________________________________________________________
consensus TGTGAAATATGTTATGTTATTTGGAGGCCAAGTGAATGGTTAACAGATTGAATTGGTAGG
 
. : . : . : . : . : . :
rJMSF013J05+ TGGATGTGTTATGTGTATTATTGTATGTTTTGTGGTTTAGGATAATGCTTTTATTTTTAT
rJMSF045A11+ TGGATGTGTTATGTGTATTATTGTATGTTTTGTGGTTTAGGATAATGCTTTTATTTTTAT
rJMSF046K20+ TAAATGTGTTATGTG---TAGTGTATGTCTTGTGGTTTAGGATAATACTTTTGTTTTTCT
rJMFF031E05+ TGGATGTGTTATGTGTATTATTGTATGTTTTGTGGTTTAGGATAATGCTTTTATTTTTAT
                      ____________________________________________________________
consensus TGGATGTGTTATGTGTATTATTGTATGTTTTGTGGTTTAGGATAATGCTTTTATTTTTAT
 
. : . : . : . : . : . :
rJMSF013J05+ CAAGACTTACGTTTTGACCTTTCCCTTGTATGATACCTTATGGGGAGT
rJMSF045A11+ CAAGACTTACGTTTTGA-CTTTCCCTTGTATGATA-CTTATGGGGAGT
rJMSF046K20+ CAAGA
rJMFF031E05+ CAAGACTTACGTTTTGA-CTTT-CCTTGTATGATA-CTTATGGGGAGTTGTATTTTACCC
                      ____________________________________________________________
consensus CAAGACTTACGTTTTGA-CTTTCCCTTGTATGATA-CTTATGGGGAGTTGTATTTTACCC