Previous Contig 009657:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031C19Sequence507001415 (2)gb:AX093582_14611255e-21Sequence 3 from Patent WO0118190.619009657 (2)gb:AX093582_14611253e-54Sequence 3 from Patent WO0118190.
JMSF038P13Sequence611006974 (4)pir|H96732|H967323e-55hypothetical protein F15H11.7 [imported] - Arabidopsis thaliana>gb:AE005173_8946810009657 (2)gb:AY518884_16109226e-36Brassica napus putative proteasome 20S beta1 subunit mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038P13+ TCATATCTTGACTACT
                      ____________________________________________________________
consensus TCATATCTTGACTACT
 
. : . : . : . : . : . :
rJMSF038P13+ GATTCTAGTCTCCGAAAAAGCAACAAGAGTTCATTCGTTAAGTCTATGCAGTGCTGAGCA
                      ____________________________________________________________
consensus GATTCTAGTCTCCGAAAAAGCAACAAGAGTTCATTCGTTAAGTCTATGCAGTGCTGAGCA
 
. : . : . : . : . : . :
rJMSF038P13+ ACCGGCCTGGAGATGCAAGCAACTTTGTACAGGGAATTGGATCAGACTTCGGTTCGGATA
                      ____________________________________________________________
consensus ACCGGCCTGGAGATGCAAGCAACTTTGTACAGGGAATTGGATCAGACTTCGGTTCGGATA
 
. : . : . : . : . : . :
rJMSF038P13+ CACAGCTTGTATACAAACACTATGCTACCTTATACTTTGTATTACTATTTGATAATTCTG
                      ____________________________________________________________
consensus CACAGCTTGTATACAAACACTATGCTACCTTATACTTTGTATTACTATTTGATAATTCTG
 
. : . : . : . : . : . :
rJMSF038P13+ AGAATGAACTTGCTATGCTTGATCTAATACAAGAATATGCTTCAAACTGGGCTTATTGTT
                      ____________________________________________________________
consensus AGAATGAACTTGCTATGCTTGATCTAATACAAGAATATGCTTCAAACTGGGCTTATTGTT
 
. : . : . : . : . : . :
rJMSF038P13+ GGTGGCTGGGACAAACATGAAGGAGGTAAAATATNTGGGATACCCCTTGGAGGCACAATA
                      ____________________________________________________________
consensus GGTGGCTGGGACAAACATGAAGGAGGTAAAATATNTGGGATACCCCTTGGAGGCACAATA
 
. : . : . : . : . : . :
rJMSF038P13+ TTGGAGCAGCCTTTTGCTATTGGAGGATCAGGCTCTTCTTATTTATATGGTTTCTTTGAC
                      ____________________________________________________________
consensus TTGGAGCAGCCTTTTGCTATTGGAGGATCAGGCTCTTCTTATTTATATGGTTTCTTTGAC
 
. : . : . : . : . : . :
rJMSF038P13+ CAAGCATGGAAGGAAGGAATGACCCAAGAAGAAGCTGAGAAATTTGTGGTTAAAGCAGTG
                      ____________________________________________________________
consensus CAAGCATGGAAGGAAGGAATGACCCAAGAAGAAGCTGAGAAATTTGTGGTTAAAGCAGTG
 
. : . : . : . : . : . :
rJMSF038P13+ TCTCTTGCCATTGCGCGGGATGGTGCCAGTGGTGGCGTAGTTCGGACTGTTACTTGGCAA
rJMFF031C19+ TGGCGA
                      ____________________________________________________________
consensus TCTCTTGCCATTGCGCGGGATGGTGCCAGTGGTGGCGTAGTTCGGACTGTTACTTGGCGA
 
. : . : . : . : . : . :
rJMSF038P13+ AGATGCATACAAGAAAATACGAGTTGATGCTACACTTGTGCAACTCTACACAGCCTTTGC
rJMFF031C19+ AGATGCATACAAGAAAATACGAGCTGGTGCTACACTTGTGCAGCTCTACACAGCCCTTGC
                      ____________________________________________________________
consensus AGATGCATACAAGAAAATACGAGTTGGTGCTACACTTGTGCAGCTCTACACAGCCTTTGC
 
. : . : . : . : . : . :
rJMSF038P13+ ATATGGGGGGCCTGCC
rJMFF031C19+ ATATGGGGGGCCTGCCCTTATACCCAAGATAAAGGCCGAACTCACCCAATGTTTAGAAAG
                      ____________________________________________________________
consensus ATATGGGGGGCCTGCCCTTATACCCAAGATAAAGGCCGAACTCACCCAATGTTTAGAAAG
 
. : . : . : . : . : . :
rJMFF031C19+ GGACGGTTATAAGACAATCCACGAGGCCGTTGGAGCAGATTGCCGATAGTCTGGAGCAAC
                      ____________________________________________________________
consensus GGACGGTTATAAGACAATCCACGAGGCCGTTGGAGCAGATTGCCGATAGTCTGGAGCAAC
 
. : . : . : . : . : . :
rJMFF031C19+ AAGCAGTTGCTCTAGAGCTCTTGGAGCGACCTCGTTTATCCACATACAATAAAAATCTAG
                      ____________________________________________________________
consensus AAGCAGTTGCTCTAGAGCTCTTGGAGCGACCTCGTTTATCCACATACAATAAAAATCTAG
 
. : . : . : . : . : . :
rJMFF031C19+ TTACTAATTGAAGAGAAAGGTTCTCCCTGGATTTTCTTGGCTGACATTTGTGATATTTTA
                      ____________________________________________________________
consensus TTACTAATTGAAGAGAAAGGTTCTCCCTGGATTTTCTTGGCTGACATTTGTGATATTTTA
 
. : . : . : . : . : . :
rJMFF031C19+ ATGTATTCTTTTTGAATCTTATTCCCCTTTGTTTTGCCCCTCTGTGGGAGGGGTAGATTT
                      ____________________________________________________________
consensus ATGTATTCTTTTTGAATCTTATTCCCCTTTGTTTTGCCCCTCTGTGGGAGGGGTAGATTT
 
. : . : . : . : . : . :
rJMFF031C19+ TGACATGTAACATCTTTCTTCTTCAGTGGCTAACATTTGGTCTAAGTTTACATAATCAAG
                      ____________________________________________________________
consensus TGACATGTAACATCTTTCTTCTTCAGTGGCTAACATTTGGTCTAAGTTTACATAATCAAG