Previous Contig 009652:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031A10Sequence134002869 (7)623009652 (4)pir|B96582|B965822e-52hypothetical protein F15I1.21 [imported] - Arabidopsis thaliana>gb:AE005173_8933
JMFS158H05Sequence384009652 (4)gb:AC125472_17405072e-44Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0050H14, complet
JMFS160C12Sequence625009652 (4)gb:AC125472_17405071e-61Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0050H14, complet
JMSF003O23Sequence163002869 (7)718009652 (4)gb:AC125472_17405077e-61Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0050H14, complet

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS158H05- CAAGGGAGGCTCCCTCGGGGCCGAGATTGTGTACA
JMFS160C12- CAAGGGAGGCTCCCTCGGGGCCGAGATTGTGTACA
rJMSF003O23+ GGGCCGAGATTGTGTACA
                      ____________________________________________________________
consensus CAAGGGAGGCTCCCTCGGGGCCGAGATTGTGTACA
 
. : . : . : . : . : . :
JMFS158H05- TCATTGGTGCTGGCTCGGGTGGCGTCCTGGGAGGCCTTGCGTTCGTCTACACCAAACCCG
JMFS160C12- TCATTGGTGCTGGCTCGGGTGGCGTCCTGGGAGGCCTTGCGTTCGTCTACACCAAACCCG
rJMSF003O23+ GCATTGGTGCTGGCTCGGGTGGCGTCCTGGGAGGCCTTGCGTTCGTCTACACCAAACCCG
                      ____________________________________________________________
consensus TCATTGGTGCTGGCTCGGGTGGCGTCCTGGGAGGCCTTGCGTTCGTCTACACCAAACCCG
 
. : . : . : . : . : . :
JMFS158H05- ATCGCCCACCCGAGAAGTTCTTGTTCCCGTGGATCTTCGGGGGGTTCTTCATGAGCATCA
JMFS160C12- ATCGCCCACCCGAGAAGTTCTTGTTCCCGTGGATCTTCGGGGGGTTCTTCATGAGCATCA
rJMSF003O23+ ATCGCCCACCCGAGAAGTTCTTGTTCCCGTGGATCTTCGGGGGGTTCTTCATGAGCATCA
rJMFF031A10+ CGGGGGGTTCTTCATGAGCATCA
                      ____________________________________________________________
consensus ATCGCCCACCCGAGAAGTTCTTGTTCCCGTGGATCTTCGGGGGGTTCTTCATGAGCATCA
 
. : . : . : . : . : . :
JMFS158H05- TATGGTTCTACATCGTGGCAAATGAACTAGTCGCCCTCTTAGTGGCATTCGGGGTCATAT
JMFS160C12- TATGGTTCTACATCGTGGCAAATGAACTAGTCGCCCTCTTAGTGGCATTCGGGGTCATAT
rJMSF003O23+ TATGGTTCTACATCGTGGCAAATGAACTAGTCGCCCTCTTAGTGGCATTCGGGGTCATAT
rJMFF031A10+ TATGGTTCTACATCGTGGCAAATGAACTAGTCGCCCTCTTAGTGGCATTCGGGGTCATAT
                      ____________________________________________________________
consensus TATGGTTCTACATCGTGGCAAATGAACTAGTCGCCCTCTTAGTGGCATTCGGGGTCATAT
 
. : . : . : . : . : . :
JMFS158H05- TTGGCATCAACCCCTCGCTCCTTGCCTTAACCGTCTTGGCTTGGGGCAACTCGATGGGAG
JMFS160C12- TTGGCATCAACCCCTCGCTCCTTGCCTTAACCGTCTTGGCTTGGGGCAACTCGATGGGAG
rJMSF003O23+ TTGGCATCAACCCCTCGCTCCTTGCCTTAACCGTCTTGGCTTGGGGCAACTCGATGGGAG
rJMFF031A10+ TTGGCATCAACCCCTCGCTCCTTGCCTTAACCGTCTTGGCTTGGGGCAACTCGATGGGAG
                      ____________________________________________________________
consensus TTGGCATCAACCCCTCGCTCCTTGCCTTAACCGTCTTGGCTTGGGGCAACTCGATGGGAG
 
. : . : . : . : . : . :
JMFS158H05- ACCTGATCTCCAACGTCGCCATTGCCATGAACAACCGAGATGGCGTGCAGATCGCCATGT
JMFS160C12- ACCTGATCTCCAACGTCGCCATTGCCATGAACAACCGAGATGGCGTGCAGATCGCCATGT
rJMSF003O23+ ACCTGATCTCCAACGTCGCCATTGCCATGAACAACCGAGATGGCGTGCAGATCGCCATGT
rJMFF031A10+ ACCTGATCTCCAACGTCGCCATTGCCATGAACAACCGAGATGGCGTGCAGATCGCCATGT
                      ____________________________________________________________
consensus ACCTGATCTCCAACGTCGCCATTGCCATGAACAACCGAGATGGCGTGCAGATCGCCATGT
 
. : . : . : . : . : . :
JMFS158H05- CGGGCTCCTATGCGGGGCCAATGTTCAACACGCTCGTTGGGCTCGGCAT
JMFS160C12- CGGGCTCCTATGCGGGGCCAATGTTCAACACGCTCGTTGGGCTCGGCATCTCCATGATGC
rJMSF003O23+ CGGGCTCCTATGCGGGGCCAATGTTCAACACGCTCGTTGGGCTCGGCATCTCCATGATGC
rJMFF031A10+ CGGGCTCCTATGCGGGGCCAATGTTCAACACGCTCGTTGGGCTCGGCATCTCCATGATGC
                      ____________________________________________________________
consensus CGGGCTCCTATGCGGGGCCAATGTTCAACACGCTCGTTGGGCTCGGCATCTCCATGATGC
 
. : . : . : . : . : . :
JMFS160C12- TGGGAGCATGGTCAAAACAACCCGACCCCTACACGATTCCACGGGACAACAACTTGTATT
rJMSF003O23+ TGGGAGCATGGTCAAAACAACCCGACCCCTACACGATTCCACGGGACAACAACTTGTATT
rJMFF031A10+ TGGGAGCATGGTCAAAACAACCCGACCCCTACACGATTCCACGGGACAACAACTTGTATT
                      ____________________________________________________________
consensus TGGGAGCATGGTCAAAACAACCCGACCCCTACACGATTCCACGGGACAACAACTTGTATT
 
. : . : . : . : . : . :
JMFS160C12- ACACGCTGGGATTTCTGATGCTGGCGCTTCTGTTTACCCTCGTTGTGCTGCCGAGAAATG
rJMSF003O23+ ACACGCTGGGATTTCTGATGCTGGCGCTTCTGTTTACCCTCGTTGTGCTGCCGAGAAATG
rJMFF031A10+ ACACGCTGGGATTTCTGATGCTGGCGCTTCTGTTTACCCTCGTTGTGCTGCCGAGAAATG
                      ____________________________________________________________
consensus ACACGCTGGGATTTCTGATGCTGGCGCTTCTGTTTACCCTCGTTGTGCTGCCGAGAAATG
 
. : . : . : . : . : . :
JMFS160C12- GGATGCGCCCGAGCAGGCTGTTAGGCTTGGGACTTATGACCATTTACTTGGTGTTTCTTT
rJMSF003O23+ GGATGCGCCCGAGCAGGCTGTTAGGCTTGGGACTTATGACCATTTACTTGGTGTTTCTTT
rJMFF031A10+ GGATGCGCCCGAGCAGGCTGTTAGGCTTGGGACTTATGACCATTTACTTGGTGTTTCTTT
                      ____________________________________________________________
consensus GGATGCGCCCGAGCAGGCTGTTAGGCTTGGGACTTATGACCATTTACTTGGTGTTTCTTT
 
. : . : . : . : . : . :
JMFS160C12- CTGTCAGGGCTACCATTGCAGTGGGTGATGGATCACTCCTGTTTCGGCCT
rJMSF003O23+ CTGTCAGGGCTACCATTGCAGTGGGTGATGGATCACTCCTGTTTCGGCCTTGAACTTTTG
rJMFF031A10+ CTGTCAGGGCTACCATTGCAGTGGGTGATGGATCACTCCTGTTTCGGCCTTGAACTTTTG
                      ____________________________________________________________
consensus CTGTCAGGGCTACCATTGCAGTGGGTGATGGATCACTCCTGTTTCGGCCTTGAACTTTTG
 
. : . : . : . : . : . :
rJMSF003O23+ GATCCATCCATATATGATGATGATGAAAAAACTAAATGTAGTATCCCCAAGATGCATATA
rJMFF031A10+ GATCCATCCATATATGATGATGATGAAAAAACTAAATGTAGTATCCCCAAGATGCATATA
                      ____________________________________________________________
consensus GATCCATCCATATATGATGATGATGAAAAAACTAAATGTAGTATCCCCAAGATGCATATA
 
. : . : . : . : . : . :
rJMSF003O23+ TGATGAATTACTGTTTGTTTTTGTGTAACATAGAGAGTAG
rJMFF031A10+ TGATGAATTACTGTTTGTTTTTGTGTAACATAGAGAGTAGTTCTTGTGTACATTCTGAGC
                      ____________________________________________________________
consensus TGATGAATTACTGTTTGTTTTTGTGTAACATAGAGAGTAGTTCTTGTGTACATTCTGAGC