Previous Contig 009648:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030N23Sequence539009648 (2)gb:AP004818_18456620.013Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P055712009648 (2)gb:BC075450_25585530.007Xenopus tropicalis HRG protein, mRNA (cDNA clone IMAGE:7017897), partial cds.>gb

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF030N23- TTCTTGCCTTTGATTTATTATTATTCCGAGTATAGTACTTTACATTCTAGTT
                      ____________________________________________________________
consensus TTCTTGCCTTTGATTTATTATTATTCCGAGTATAGTACTTTACATTCTAGTT
 
. : . : . : . : . : . :
rJMFF030N23- ACTTGTACATCTCACGGGTTGATCTAGTTAACCTAGCCTTAATGTTGAGGCATAGTTTCT
                      ____________________________________________________________
consensus ACTTGTACATCTCACGGGTTGATCTAGTTAACCTAGCCTTAATGTTGAGGCATAGTTTCT
 
. : . : . : . : . : . :
JMFF030N23+ TTTTCACAGTTA
rJMFF030N23- TGCCATAAATATCCATAACCATCATCACCATCCATTATCGTACTACGATTTTCACAGTTA
                      ____________________________________________________________
consensus TGCCATAAATATCCATAACCATCATCACCATCCATTATCGTACTACGATTTTCACAGTTA
 
. : . : . : . : . : . :
JMFF030N23+ GGGTAATCTGCAAACCAAGAGTTGACGACGACGCCCTCATTTGGTATGGAGAATGAAGAT
rJMFF030N23- GGGTAATCTGCAAACCAAGAGTTGACGACGACGCCCTCATTTGGTATGGAGAATGAAGAT
                      ____________________________________________________________
consensus GGGTAATCTGCAAACCAAGAGTTGACGACGACGCCCTCATTTGGTATGGAGAATGAAGAT
 
. : . : . : . : . : . :
JMFF030N23+ TCTATTTCCATTTCCATCTCCATATCCATCAACTTCAAATCATCAAGAGCACTGGGTTCC
rJMFF030N23- TCTATTTCCATTTCCATCTCCATATCCATCAACTTCAAATCATCAAGAGCACTGGGTTCC
                      ____________________________________________________________
consensus TCTATTTCCATTTCCATCTCCATATCCATCAACTTCAAATCATCAAGAGCACTGGGTTCC
 
. : . : . : . : . : . :
JMFF030N23+ CAGAAATGTTGATTTTTAAAATTATTATCAGAATCCTCGAAAGACGACTGATGATAATGA
rJMFF030N23- CAGAAATGTTGATTTTTAAAATTATTATCAGAATCCTCGAAAGACGACTGATGATAATGA
                      ____________________________________________________________
consensus CAGAAATGTTGATTTTTAAAATTATTATCAGAATCCTCGAAAGACGACTGATGATAATGA
 
. : . : . : . : . : . :
JMFF030N23+ TGACTGTCTGTAAAGAAATCATAGTCATCATCAACCGCCGCCGTACGGCCGTCGATTTCG
rJMFF030N23- TGACTGTCTGTAAAGAAATCATAGTCATCATCAACCGCCGCCGTACGGCCGTCGATTTCG
                      ____________________________________________________________
consensus TGACTGTCTGTAAAGAAATCATAGTCATCATCAACCGCCGCCGTACGGCCGTCGATTTCG
 
. : . : . : . : . : . :
JMFF030N23+ GCTTCCAAGGATTGGATCACACTCCTTAATCTCTCGTCATCGTAATCCTCTCCGACCACG
rJMFF030N23- GCTTCCAAGGATTGGATCACACTCCTTAATCTCTCGTCATCGTAATCCTCTCCGACCACG
                      ____________________________________________________________
consensus GCTTCCAAGGATTGGATCACACTCCTTAATCTCTCGTCATCGTAATCCTCTCCGACCACG
 
. : . : . : . : . : . :
JMFF030N23+ CCTTGCGTGTCGTCAAGTATTGACATGAGCAGCGCAGAGTCAACTTCGGAGAAGTCGCCG
rJMFF030N23- CCTTGCGTGTCGTCAAGTATTGACATGAGCAGCGCAGAGTCAACTTCGGAGAAGTCGCCG
                      ____________________________________________________________
consensus CCTTGCGTGTCGTCAAGTATTGACATGAGCAGCGCAGAGTCAACTTCGGAGAAGTCGCCG
 
. : . : . : . : . : . :
JMFF030N23+ TTGTTGCGGATGAACTCATCGTCGCCGGCGAAGGATGCCCAGTTCTCAGGTATCGCGGCG
rJMFF030N23- TTGTTGCGGATGAACTCATCGTCGCCGGCGAAGGATGCCCAGTTCTCAGGTATCGCGGCG
                      ____________________________________________________________
consensus TTGTTGCGGATGAACTCATCGTCGCCGGCGAAGGATGCCCAGTTCTCAGGTATCGCGGCG
 
. : . : . : . : . : . :
JMFF030N23+ GCCATATATGCGTTTTACAAGGGATCGAGATAGATGGATTGGAAGAGATGAGAGTAGAAT
rJMFF030N23- GCCATATATGCGTTTTACAAGGGATCGAGATAGATGGATTGGAAGAGATGAGAGTAGAAT
                      ____________________________________________________________
consensus GCCATATATGCGTTTTACAAGGGATCGAGATAGATGGATTGGAAGAGATGAGAGTAGAAT
 
. : . : . : . : . : . :
JMFF030N23+ TAGTGGAGAAAGGGTTTGAAGATGATGATGCAGATTGCAGTTGGGAC
rJMFF030N23- TAGTGGAGAAAGGGTTTGAAGATGATGATGCAGATTGCAGTTGGGACCGGTTCTCGACGA
                      ____________________________________________________________
consensus TAGTGGAGAAAGGGTTTGAAGATGATGATGCAGATTGCAGTTGGGACCGGTTCTCGACGA