Previous Contig 009647:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005H05Sequence495009647 (29)gb:AY365248_16028817e-52Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.780009647 (29)gb:AB049724_15209135e-73Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete c
JMFF007C23Sequence398009647 (29)gb:AY365248_16028811e-33Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.
JMFF009E21Sequence499009647 (29)gb:AY365248_16028816e-51Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.683009647 (29)gb:AB049724_15209133e-57Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete c
JMFF014N08Sequence605009647 (29)gb:AY365248_16028817e-65Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.690009647 (29)gb:AB049724_15209133e-57Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete c
JMFF015C06Sequence562009647 (29)gb:AY365248_16028812e-62Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.685009647 (29)gb:AB049724_15209131e-57Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete c
JMFF019O19Sequence537009647 (29)gb:AY365248_16028814e-57Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.722009647 (29)gb:AB049724_15209131e-66Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete c
JMFF023P23Sequence467009647 (29)gb:AY365248_16028812e-46Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.749009647 (29)gb:AB049724_15209132e-73Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete c
JMFF025B15Sequence525009647 (29)gb:AY365248_16028817e-56Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.669009647 (29)gb:AB049724_15209132e-61Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete c
JMFF027L01Sequence580009647 (29)gb:AY365248_16028813e-60Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.771009647 (29)gb:AB049724_15209131e-73Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete c
JMFF030N22Sequence550009647 (29)gb:AY365248_16028812e-62Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.703009647 (29)gb:AB049724_15209136e-51Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete c
JMFF046E06Sequence577009647 (29)gb:AY365248_16028814e-60Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.517009647 (29)gb:AB049724_15209133e-33Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete c
JMFF050P01Sequence619009647 (29)gb:AY365248_16028812e-62Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.563009647 (29)gb:AB049724_15209137e-48Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete c
JMFF051D19Sequence520009647 (29)gb:AY365248_16028813e-55Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.486009647 (29)gb:AB049724_15209137e-34Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete c
JMFN029D07Sequence568009647 (29)gb:AB049724_15209131e-34Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete c
JMFN029I12Sequence609009647 (29)gb:AB049724_15209133e-54Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete c
JMSF029D07Sequence654009647 (29)gb:AY365248_16028813e-65Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.749009647 (29)gb:AB049724_15209131e-72Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete c

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007C23- TCCTTTTTATCACTCTTCTACTTCCCTCCCGACAACCA
JMFF009E21- ACTCTCCTTTTTATCACTCTTCTACTTCCCTCCCGACAACCA
JMFF019O19- ACTCTCCTTTTTATCACTCTTCTACTTCCCTCCCGACAACCA
JMFF005H05- ATCACTCTTCTACTTCCCTCCCGACAACCA
JMFF015C06- ACTCTCCTTTTTATCACTCTTCTACTTCCCTCCCGACAACCA
JMFF027L01- ATCACTCTTCTACTTCCCTCCCGACAACCA
JMFF046E06- ATCACTCTTCTACTTCCCTCCCGAC-ACCA
JMFF030N22- ATCACTCTTCTACTTCCCTCCCGACAACCA
JMFF051D19- CACTCTTCTACTTCCCTCCCGACAACCA
JMFF023P23- CACTCTTCTACTTCCCTCCCGACAACCA
JMFF025B15- ATCACTCTTCTACTTCCCTCCCGACAACCA
JMFF014N08- ATCACTCTTCTACTTCCCTCCCGACAACCA
JMFF050P01- ATCACTCTTCTACTTCCCTCCCGACAACCA
                      ____________________________________________________________
consensus ACTCTCCTTTTTATCACTCTTCTACTTCCCTCCCGACAACCA
 
. : . : . : . : . : . :
JMFF007C23- CTCGGCGGCGGAGGCTATCGGAGCTGTAACAATGGNCTTCATCANAGTCCAGAAGACAAG
JMFF009E21- CTCGGCGGCGGAGGCTATCGGAGCTGTAACAATGGCCTTCATCAAAGTCCAGAAGACAAG
JMFF019O19- CTCGGCGGCGGAGGCTATCGGAGCTGTAACAATGGCCTTCATCAAAGTCCAGAAGACAAG
JMFF005H05- CTCGGCGGCGGAGGCTATCGGAGCTGTAACAATGGCCTTCATCAAAGTCCAGAAGACAAG
JMFF015C06- CTCGGCGGCGGAGGCTATCGGAGCTGTAACAATGGCCTTCATCAAAGTCCAGAAGACAAG
JMFF027L01- CTCGGCGGCGGAGGCTATCGGAGCTGTAACAATGGCCTTCATCAAAGTCCAGAAGACAAG
JMFF046E06- CTCGGCGGCGGAGGCTATCGGAGCTGTAACAATGGCCTTCATCAAAGTCCAGAAGACAAG
JMFF030N22- CTCGGCGGCGGAGGCTATCGGAGCTGTAACAATGGCCTTCATCAAAGTCCAGAAGACAAG
JMFF051D19- CTCGGCGGCGGAGGCTATCGGAGCTGTAACAATGGCCTTCATCAAAGTCCAGAAGACAAG
JMFF023P23- CTCGGCGGCGGAGGCTATCGGAGCTGTAACAATGGCCTTCATCAAAGTCCAGAAGACAAG
JMFF025B15- CTCGGCGGCGGAGGCTATCGGAGCTGTAACAATGGCCTTCATCAAAGTCCAGAAGACAAG
JMFF014N08- CTCGGCGGCGGAGGCTATCGGAGCTGTAACAATGGCCTTCATCAAAGTCCAGAAGACAAG
JMSF029D07- CAATGGCCTTCATCAAAGTCCAGAAGACAAG
JMFF050P01- CTCGGCGGCGGAGGCTATCGGAGCTGTAACAATGGCCTTCATCAAAGTCCAGAAGACAAG
                      ____________________________________________________________
consensus CTCGGCGGCGGAGGCTATCGGAGCTGTAACAATGGCCTTCATCAAAGTCCAGAAGACAAG
 
. : . : . : . : . : . :
JMFF007C23- AGCTTACTTCAAGCGATTCCAGGTCAAGTTCAAGAGAAGAAGAGAGGGCAAGACCGACTA
JMFF009E21- AGCTTACTTCAAGCGATTCCAGGTCAAGTTCAAGAGAAGAAGAGAGGGCAAGACCGACTA
JMFF019O19- AGCTTACTTCAAGCGATTCCAGGTCAAGTTCAAGAGAAGAAGAGAGGGCAAGACCGACTA
JMFF005H05- AGCTTACTTCAAGCGATTCCAGGTCAAGTTCAAGAGAAGAAGAGAGGGCAAGACCGACTA
JMFF015C06- AGCTTACTTCAAGCGATTCCAGGTCAAGTTCAAGAGAAGAAGAGAGGGCAAGACCGACTA
JMFF027L01- AGCTTACTTCAAGCGATTCCAGGTCAAGTTCAAGAGAAGAAGAGAGGGCAAGACCGACTA
JMFF046E06- AGCTTACTTCAAGCGATTCCAGGTCAAGTTCAAGAGAAGAAGAGAGGGCAAGACCGACTA
JMFF030N22- AGCTTACTTCAAGCGATTCCAGGTCAAGTTCAAGAGAAGAAGAGAGGGCAAGACCGACTA
JMFF051D19- AGCTTACTTCAAGCGATTCCAGGTCAAGTTCAAGAGAAGAAGAGAGGGCAAGACCGACTA
JMFF023P23- AGCTTACTTCAAGCGATTCCAGGTCAAGTTCAAGAGAAGAAGAGAGGGCAAGACCGACTA
JMFF025B15- AGCTTACTTCAAGCGATTCCAGGTCAAGTTCAAGAGAAGAAGAGAGGGCAAGACCGACTA
JMFF014N08- AGCTTACTTCAAGCGATTCCAGGTCAAGTTCAAGAGAAGAAGAGAGGGCAAGACCGACTA
JMSF029D07- AGCTTACTTCAAGCGATTCCAGGTCAAGTTCAAGAGAAGAAGAGAGGGCAAGACCGACTA
JMFF050P01- AGCTTACTTCAAGCGATTCCAGGTCAAGTTCAAGAGAAGAAGAGAGGGCAAGACCGACTA
                      ____________________________________________________________
consensus AGCTTACTTCAAGCGATTCCAGGTCAAGTTCAAGAGAAGAAGAGAGGGCAAGACCGACTA
 
. : . : . : . : . : . :
JMFF007C23- TCGTGCTAGGAATCGGTTGATCAATCAGGACAAGAACAAGTACAACACTCCANAATACAG
JMFF009E21- TCGTGCTAGGAATCGGTTGATCAATCAGGACAAGAACAAGTACAACACTCCAAAATACAG
JMFF019O19- TCGTGCTAGGAATCGGTTGATCAATCAGGACAAGAACAAGTACAACACTCCAAAATACAG
JMFF005H05- TCGTGCTAGGAATCGGTTGATCAATCAGGACAAGAACAAGTACAACACTCCAAAATACAG
JMFF015C06- TCGTGCTAGGAATCGGTTGATCAATCAGGACAAGAACAAGTACAACACTCCAAAATACAG
JMFF027L01- TCGTGCTAGGAATCGGTTGATCAATCAGGACAAGAACAAGTACAACACTCCAAAATACAG
JMFF046E06- TCGTGCTAGGAATCGGTTGATCAATCAGGACAAGAACAAGTACAACACTCCAAAATACAG
JMFF030N22- TCGTGCTAGGAATCGGTTGATCAATCAGGACAAGAACAAGTACAACACTCCAAAATACAG
JMFF051D19- TCGTGCTAGGAATCGGTTGATCAATCAGGACAAGAACAAGTACAACACTCCAAAATACAG
JMFF023P23- TCGTGCTAGGAATCGGTTGATCAATCAGGACAAGAACAAGTACAACACTCCAAAATACAG
JMFF025B15- TCGTGCTAGGAATCGGTTGATCAATCAGGACAAGAACAAGTACAACACTCCAAAATACAG
JMFF014N08- TCGTGCTAGGAATCGGTTGATCAATCAGGACAAGAACAAGTACAACACTCCAAAATACAG
JMSF029D07- TCGTGCTAGGAATCGGTTGATCAATCAGGACAAGAACAAGTACAACACTCCAAAATACAG
JMFF050P01- TCGTGCTAGGAATCGGTTGATCAATCAGGACAAGAACAAGTACAACACTCCAAAATACAG
                      ____________________________________________________________
consensus TCGTGCTAGGAATCGGTTGATCAATCAGGACAAGAACAAGTACAACACTCCAAAATACAG
 
. : . : . : . : . : . :
JMFF007C23- ATTTGTTGTCCGATTTACCAACAAGGATATAATTGCACNAATTGNATCTGCTAGTATTGC
JMFF009E21- ATTTGTTGTCCGATTTACCAACAAGGATATAATTGCACAAATTGTATCTGCTAGTATTGC
JMFF019O19- ATTTGTTGTCCGATTTACCAACAAGGATATAATTGCACAAATTGTATCTGCTAGTATTGC
JMFF005H05- ATTTGTTGTCCGATTTACCAACAAGGATATAATTGCACAAATTGTATCTGCTAGTATTGC
JMFF015C06- ATTTGTTGTCCGATTTACCAACAAGGATATAATTGCACAAATTGTATCTGCTAGTATTGC
JMFF027L01- ATTTGTTGTCCGATTTACCAACAAGGATATAATTGCACAAATTGTATCTGCTAGTATTGC
JMFF046E06- ATTTGTTGTCCGATTTACCAACAAGGATATAATTGCACAAATTGTATCTGCTAGTATTGC
JMFF030N22- ATTTGTTGTCCGATTTACCAACAAGGATATAATTGCACAAATTGTATCTGCTAGTATTGC
JMFF051D19- ATTTGTTGTCCGATTTACCAACAAGGATATAATTGCACAAATTGTATCTGCTAGTATTGC
JMFF023P23- ATTTGTTGTCCGATTTACCAACAAGGATATAATTGCACAAATTGTATCTGCTAGTATTGC
JMFF025B15- ATTTGTTGTCCGATTTACCAACAAGGATATAATTGCACAAATTGTATCTGCTAGTATTGC
JMFF014N08- ATTTGTTGTCCGATTTACCAACAAGGATATAATTGCACAAATTGTATCTGCTAGTATTGC
JMSF029D07- ATTTGTTGTCCGATTTACCAACAAGGATATAATTGCACAAATTGTATCTGCTAGTATTGC
JMFF050P01- ATTTGTTGTCCGATTTACCAACAAGGATATAATTGCACAAATTGTATCTGCTAGTATTGC
                      ____________________________________________________________
consensus ATTTGTTGTCCGATTTACCAACAAGGATATAATTGCACAAATTGTATCTGCTAGTATTGC
 
. : . : . : . : . : . :
JMFF007C23- TGGTGACATGATTCTTGCTTCTGCTTATGCCCATGAACTGCCTCGTTATGGCCTTGAGGT
JMFF009E21- TGGTGACATGATTCTTGCTTCTGCTTATGCCCATGAACTGCCTCGTTATGGCCTTGAGGT
JMFF019O19- TGGTGACATGATTCTTGCTTCTGCTTATGCCCATGAACTGCCTCGTTATGGCCTTGAGGT
JMFF005H05- TGGTGACATGATTCTTGCTTCTGCTTATGCCCATGAACTGCCTCGTTATGGCCTTGAGGT
JMFF015C06- TGGTGACATGATTCTTGCTTCTGCTTATGCCCATGAACTGCCTCGTTATGGCCTTGAGGT
JMFF027L01- TGGTGACATGATTCTTGCTTCTGCTTATGCCCATGAACTGCCTCGTTATGGCCTTGAGGT
JMFF046E06- TGGTGACATGATTCTTGCTTCTGCTTATGCCCATGAACTGCCTCGTTATGGCCTTGAGGT
JMFF030N22- TGGTGACATGATTCTTGCTTCTGCTTATGCCCATGAACTGCCTCGTTATGGCCTTGAGGT
JMFF051D19- TGGTGACATGATTCTTGCTTCTGCTTATGCCCATGAACTGCCTCGTTATGGCCTTGAGGT
JMFF023P23- TGGTGACATGATTCTTGCTTCTGCTTATGCCCATGAACTGCCTCGTTATGGCCTTGAGGT
JMFF025B15- TGGTGACATGATTCTTGCTTCTGCTTATGCCCATGAACTGCCTCGTTATGGCCTTGAGGT
JMFF014N08- TGGTGACATGATTCTTGCTTCTGCTTATGCCCATGAACTGCCTCGTTATGGCCTTGAGGT
JMSF029D07- TGGTGACATGATTCTTGCTTCTGCTTATGCCCATGAACTGCCTCGTTATGGCCTTGAGGT
JMFF050P01- TGGTGACATGATTCTTGCTTCTGCTTATGCCCATGAACTGCCTCGTTATGGCCTTGAGGT
                      ____________________________________________________________
consensus TGGTGACATGATTCTTGCTTCTGCTTATGCCCATGAACTGCCTCGTTATGGCCTTGAGGT
 
. : . : . : . : . : . :
JMFF007C23- TGGCCACACAAATTATGCTGCAGCTTACTGCACTGGACTTCTCTTGGCTCGGCGAC
JMFF009E21- TGGCCACACAAATTATGCTGCAGCTTACTGCACTGGACTTCTCTTGGCTCGGCGACTTCT
JMFF019O19- TGGCCACACAAATTATGCTGCAGCTTACTGCACTGGACTTCTCTTGGCTCGGCGACTTCT
JMFF005H05- TGGCCACACAAATTATGCTGCAGCTTACTGCACTGGACTTCTCTTGGCTCGGCGACTTCT
JMFF015C06- TGGCCACACAAATTATGCTGCAGCTTACTGCACTGGACTTCTCTTGGCTCGGCGACTTCT
JMFF027L01- TGGCCACACAAATTATGCTGCAGCTTACTGCACTGGACTTCTCTTGGCTCGGCGACTTCT
JMFF046E06- TGGCCACACAAATTATGCTGCAGCTTACTGCACTGGACTTCTCTTGGCTCGGCGACTTCT
JMFF030N22- TGGCCACACAAATTATGCTGCAGCTTACTGCACTGGACTTCTCTTGGCTCGGCGACTTCT
JMFF051D19- TGGCCACACAAATTATGCTGCAGCTTACTGCACTGGACTTCTCTTGGCTCGGCGACTTCT
JMFF023P23- TGGCCACACAAATTATGCTGCAGCTTACTGCACTGGACTTCTCTTGGCTCGGCGACTTCT
JMFF025B15- TGGCCACACAAATTATGCTGCAGCTTACTGCACTGGACTTCTCTTGGCTCGGCGACTTCT
JMFF014N08- TGGCCACACAAATTATGCTGCAGCTTACTGCACTGGACTTCTCTTGGCTCGGCGACTTCT
JMSF029D07- TGGCCACACAAATTATGCTGCAGCTTACTGCACTGGACTTCTCTTGGCTCGGCGACTTCT
JMFF050P01- TGGCCACACAAATTATGCTGCAGCTTACTGCACTGGACTTCTCTTGGCTCGGCGACTTCT
rJMFF023P23+ CT
rJMFF027L01+ T
                      ____________________________________________________________
consensus TGGCCACACAAATTATGCTGCAGCTTACTGCACTGGACTTCTCTTGGCTCGGCGACTTCT
 
. : . : . : . : . : . :
JMFF009E21- CCAAAAGCTTGAAATGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
JMFF019O19- CCAAAAGCTTGAAATGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
JMFF005H05- CCAAAAGCTTGAAATGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
JMFF015C06- CCAAAAGCTTGAAATGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
JMFF027L01- CCAAAAGCTTGAAATGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
JMFF046E06- CCAAAAGCTTGAAATGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
JMFF030N22- CCAAAAGCTTGAAATGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
JMFF051D19- CCAAAAGCTTGAAAAGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
JMFF023P23- CCAAAAGCTTGAAAAGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
JMFF025B15- CCAAAAGCTTGAAAAGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
JMFF014N08- CCAAAAGCTTGAAATGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
JMSF029D07- CCAAAAGCTTGAAATGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
JMFF050P01- CCAAAAGCTTGAAATGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
rJMFF023P23+ CCAAAAGCTTGAAAAGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
rJMSF029D07+ AAATGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
rJMFF027L01+ CCAAAAGCTTGAAATGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
rJMFF019O19+ CTGGAGAGGATTA
rJMFF005H05+ GCTTGAAATGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
                      ____________________________________________________________
consensus CCAAAAGCTTGAAATGGCTGAAGAGTATGAAGGAAATGTTGAGGCCACTGGAGAGGATTA
 
. : . : . : . : . : . :
JMFF009E21- TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGT
JMFF019O19- TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
JMFF005H05- TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTT
JMFF015C06- TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
JMFF027L01- TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
JMFF046E06- TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
JMFF030N22- TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
JMFF051D19- TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
JMFF023P23- TTCTGTTGAACCTGGTG
JMFF025B15- TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
JMFF014N08- TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
JMSF029D07- TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
JMFF050P01- TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
rJMFF023P23+ TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
rJMSF029D07+ TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
rJMFF027L01+ TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
rJMFF025B15+ AAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
rJMFF019O19+ TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
rJMFF009E21+ TTTTGGATGTTGGTCTATT
rJMFF015C06+ CTTTTGGATGTTGGTCTATT
rJMFF005H05+ TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
rJMFF014N08+ TTTTGGATGTTGGTCTATT
                      ____________________________________________________________
consensus TTCTGTTGAACCTGGTGAAGGCAGGAGGCCTTTCCGTGCTCTTTTGGATGTTGGTCTATT
 
. : . : . : . : . : . :
JMFF019O19- ACGAACTACCACTGG
JMFF015C06- ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAG
JMFF027L01- ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAGGGTGCACTAGATGGTGGACT
JMFF046E06- ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTCTAGGGTGCACTAGATGGTGGACT
JMFF030N22- ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAG
JMFF051D19- ACGAACTACC
JMFF025B15- ACGAACTACCACTGG
JMFF014N08- ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAGGGTGCACTAGATGGTGGACT
JMSF029D07- ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAGGGTGCACTAGATGGTGGACT
JMFF050P01- ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAGGGTGCACTAGATGGTGGACT
rJMFF023P23+ ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAGGGTGCACTAGATGGTGGACT
rJMSF029D07+ ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAGGGTGCACTAGATGGTGGACT
rJMFF027L01+ ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAGGGTGCACTAGATGGTGGACT
rJMFF025B15+ ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAGGGTGCACTAGATGGTGGACT
rJMFF019O19+ ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAGGGTGCACTAGATGGTGGACT
JMFN029I12+ CTAGATGGTGGACT
rJMFF009E21+ ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAGGGTGCACTAGATGGTGGACT
rJMFF015C06+ ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAGGGTGCACTAGATGGTGGACT
rJMFF005H05+ ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAGGGTGCACTAGATGGTGGACT
rJMFF014N08+ ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAGGGTGCACTAGATGGTGGACT
rJMFF030N22+ ATCGTGTTTTTGGTGCTCTTAAGGGTGCACTAGATGGTGGACT
                      ____________________________________________________________
consensus ACGAACTACCACTGGGAATCGTGTTTTTGGTGCTCTTAAGGGTGCACTAGATGGTGGACT
 
. : . : . : . : . : . :
JMFF027L01- TGACATTCCT
JMFF046E06- TGACATTC
JMFF014N08- TGACATTCCTCACAGTGAAAAAAGGTTTGCGGGAT
JMSF029D07- TGACATTCCTCACAGTGAAAAAAGGTTTGCGGGATTCAGCA
JMFF050P01- TGACATTCCTCACAGTG-AAAAAGGTTTGCGGGATTCAGCAAGGATTCCA
rJMFF023P23+ TGACATTCCTCACAGTGAAAAAAGGTTTGCGGGATTCAGCAAGGATTCCAAACAACTTGA
rJMSF029D07+ TGACATTCCTCACAGTGAAAAAAGGTTTGCGGGATTCAGCAAGGATTCCAAACAACTTGA
rJMFF027L01+ TGACATTCCTCACAGTGAAAAAAGGTTTGCGGGATTCAGCAAGGATTCCAAACAACTTGA
rJMFF025B15+ TGACATTCCTCACAGTGAAAAAAGGTTTGCGGGATTCAGCAAGGATTCCAAACAACTTGA
rJMFF019O19+ TGACATTCCTCACAGTGAAAAAAGGTTTGCGGGATTCAGCAAGGATTCCAAACAACTTGA
rJMFF050P01+ GAAAAAAGGTTTGCGGGATTCAGCAAGGATTCCAAACAACTTGA
JMFN029I12+ TGACATTCCTCACAGTGAAAAAAGGTTTGCGGGATTCAGCAAGGATTCCAAACAACTTGA
rJMFF009E21+ TGACATTCCTCACAGTGAAAAAAGGTTTGCGGGATTCAGCAAGGATTCCAAACAACTTGA
rJMFF015C06+ TGACATTCCTCACAGTGAAAAAAGGTTTGCGGGATTCAGCAAGGATTCCAAACAACTTGA
rJMFF005H05+ TGACATTCCTCACAGTGAAAAAAGGTTTGCGGGATTCAGCAAGGATTCCAAACAACTTGA
rJMFF014N08+ TGACATTCCTCACAGTGAAAAAAGGTTTGCGGGATTCAGCAAGGATTCCAAACAACTTGA
rJMFF030N22+ TGACATTCCTCACAGTGAAAAAAGGTTTGCGGGATTCAGCAAGGATTCCAAACAACTTGA
                      ____________________________________________________________
consensus TGACATTCCTCACAGTGAAAAAAGGTTTGCGGGATTCAGCAAGGATTCCAAACAACTTGA
 
. : . : . : . : . : . :
rJMFF023P23+ TGCTGAGGTTCACCGCAAGTACATCTATGGAGGCCATGTTGCTGCATACATGAGGAATCT
rJMSF029D07+ TGCTGAGGTTCACCGCAAGTACATCTATGGAGGCCATGTTGCTGCATACATGAGGAATCT
rJMFF027L01+ TGCTGAGGTTCACCGCAAGTACATCTATGGAGGCCATGTTGCTGCATACATGAGGAATCT
rJMFF025B15+ TGCTGAGGTTCACCGCAAGTACATCTATGGAGGCCATGTTGCTGCATACATGAGGAATCT
rJMFF019O19+ TGCTGAGGTTCACCGCAAGTACATCTATGGAGGCCATGTTGCTGCATACATGAGGAATCT
rJMFF050P01+ TGCTGAGGTTCACCGCAAGTACATCTATGGAGGCCATGTTGCTGCATACATGAGGAATCT
rJMFF051D19+ CATGTTGCTGCATACATGAGGAATCT
JMFN029I12+ TGCTGAGGTTCACCGCAAGTACATCTATGGAGGCCATGTTGCTGCATACATGAGGAATCT
rJMFF009E21+ TGCTGAGGTTCACCGCAAGTACATCTATGGAGGCCATGTTGCTGCATACATGAGGAATCT
rJMFF015C06+ TGCTGAGGTTCACCGCAAGTACATCTATGGAGGCCATGTTGCTGCATACATGAGGAATCT
rJMFF005H05+ TGCTGAGGTTCACCGCAAGTACATCTATGGAGGCCATGTTGCTGCATACATGAGGAATCT
rJMFF014N08+ TGCTGAGGTTCACCGCAAGTACATCTATGGAGGCCATGTTGCTGCATACATGAGGAATCT
JMFN029D07+ ATGGATGCCATGTTGCTGCATACATGAGGAATCT
rJMFF046E06+ CTGCATACATGAGGAATCT
rJMFF030N22+ TGCTGAGGTTCACCGCAAGTACATCTATGGAGGCCATGTTGCTGCATACATGAGGAATCT
                      ____________________________________________________________
consensus TGCTGAGGTTCACCGCAAGTACATCTATGGAGGCCATGTTGCTGCATACATGAGGAATCT
 
. : . : . : . : . : . :
rJMFF023P23+ GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTTAGTGCATACATTAAAAAGGGTAT
rJMSF029D07+ GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTTAGTGCATACATTAAAAAGGGTAT
rJMFF027L01+ GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTTAGTGCATACATTAAAAAGGGTAT
rJMFF025B15+ GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTTAGTGCATACATTAAAAAGGGTAT
rJMFF019O19+ GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTTAGTGCATACATTAAAAAGGGTAT
rJMFF050P01+ GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTTAGTGCATACATTAAAAAGGGTAT
rJMFF051D19+ GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTNAGTGCATACATTAAAAAGGGTAT
JMFN029I12+ GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTTAGTGCATACATTAAAAAGGGTAT
rJMFF009E21+ GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTTAGTGCATACATTAAAAAGGGTAT
rJMFF015C06+ GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTTAGTGCATACATTAAAAAGGGTAT
rJMFF005H05+ GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTTAGTGCATACATTAAAAAGGGTAT
rJMFF014N08+ GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTTAGTGCATACATTAAAAAGGGTAT
JMFN029D07+ GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTTAGTGCATACATTAAAAAGGGTAT
rJMFF046E06+ GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTTAGTGCATACATTAAAAAGGGTAT
rJMFF030N22+ GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTTAGTGCATACATTAAAAAGGGTAT
                      ____________________________________________________________
consensus GATTGAAGATGAGCCTGAAAAGTACCAGTCTGTATTTAGTGCATACATTAAAAAGGGTAT
 
. : . : . : . : . : . :
rJMFF023P23+ TGATGCCGATAACCTTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
rJMSF029D07+ TGATGCCGATAACCTTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
rJMFF027L01+ TGATGCCGATAACCTTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
rJMFF025B15+ TGATGCCGATAACCTTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
rJMFF019O19+ TGATGCCGATAACCTTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
rJMFF050P01+ TGATGCCGATAACCTTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
rJMFF051D19+ TGATGCCGATAACCTTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
JMFN029I12+ TGATGCCGATAACCTTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
rJMFF009E21+ TGATGCCGATAACCTTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
rJMFF015C06+ TGATGCCGATAACCTTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
rJMFF005H05+ TGATGCCGATAACCCTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
rJMFF014N08+ TGATGCCGATAACCTTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
JMFN029D07+ TGATGCCGATAACCTTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
rJMFF046E06+ TGATGCCGATAACCTTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
rJMFF030N22+ TGATGCCGATAACCTTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
                      ____________________________________________________________
consensus TGATGCCGATAACCTTGAGCAGTTGTACAAAAAGGTTCATGCGGCAATCCGCGCTGATCC
 
. : . : . : . : . : . :
rJMFF023P23+ CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
rJMSF029D07+ CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
rJMFF027L01+ CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
rJMFF025B15+ CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
rJMFF019O19+ CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
rJMFF050P01+ CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
rJMFF051D19+ CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
JMFN029I12+ CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
rJMFF009E21+ CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
rJMFF015C06+ CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
rJMFF005H05+ CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
rJMFF014N08+ CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
JMFN029D07+ CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
rJMFF046E06+ CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
rJMFF030N22+ CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
                      ____________________________________________________________
consensus CAGCGCAAAGAAATCTGAGAAGCAGCCTCCTAAGGAACACAAGAGGTACAACCTTAAGAA
 
. : . : . : . : . : . :
rJMFF023P23+ GCTAACTTATGAAGAGAGGAAAGCTAGTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
rJMSF029D07+ GCTAACTTATGAAGAGAGGAAAGCTAGTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
rJMFF027L01+ GCTAACTTATGAAGAGAGGAAAGCTAGTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
rJMFF025B15+ GCTAACTTATGAAGAGAGGAAAGCTAGTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
rJMFF019O19+ GCTAACTTATGAAGAGAGGAAAGCTAGTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
rJMFF050P01+ GCTAACTTATGAAGAGAGGAAAGCTAGTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
rJMFF051D19+ GCTAACTTATGAAGAGAGGAAAGCTAGTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
JMFN029I12+ GCTAACTTATGAAGAGAGGAAAGCTAGTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
rJMFF009E21+ GCTAACTTATGAAGAGAGGAAAGCTAGTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
rJMFF015C06+ GCTAACTTATGAAGAGAGGAAAGCTAGTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
rJMFF005H05+ GCTAACTTATGAAGAGAGGAAAGCTAGTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
rJMFF014N08+ GCTAACTTATGAAGAGAGGAAAGCTAGTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
JMFN029D07+ GCTAACTTATGAAGAGAGGAAAGCTATTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
rJMFF046E06+ GCTAACTTATGAAGAGAGGAAAGCTAGTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
rJMFF030N22+ GCTAACTTATGAAGAGAGGAAAGCTAGTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
                      ____________________________________________________________
consensus GCTAACTTATGAAGAGAGGAAAGCTAGTTTGATCTCGAGACTGAATGCCCTAAATGCTGC
 
. : . : . : . : . : . :
rJMFF023P23+ TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
rJMSF029D07+ TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
rJMFF027L01+ TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
rJMFF025B15+ TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
rJMFF019O19+ TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
rJMFF050P01+ TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
rJMFF051D19+ TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
JMFN029I12+ TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
rJMFF009E21+ TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
rJMFF015C06+ TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
rJMFF005H05+ TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
rJMFF014N08+ TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
JMFN029D07+ TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
rJMFF046E06+ TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
rJMFF030N22+ TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
                      ____________________________________________________________
consensus TGCTGGAAGAGACGACGACGATGATGATGAGGATGATGATGAGTGAATGACACATTCCGA
 
. : . : . : . : . : . :
rJMFF023P23+ AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
rJMSF029D07+ AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
rJMFF027L01+ AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
rJMFF025B15+ AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
rJMFF019O19+ AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
rJMFF050P01+ AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
rJMFF051D19+ AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
JMFN029I12+ AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
rJMFF009E21+ AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
rJMFF015C06+ AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
rJMFF005H05+ AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
rJMFF014N08+ AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
JMFN029D07+ AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
rJMFF046E06+ AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
rJMFF030N22+ AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
                      ____________________________________________________________
consensus AAACCTGAAACCATAGTTTGCATCTTAATTTCTGAGTATTTTCACCTGCATCCATTACAG
 
. : . : . : . : . : . :
rJMFF023P23+ TTGTAGTCTTTTATGGAGATTTATTAGTTTACGAGGGTGAGTTTTTACCAACTTGATGTT
rJMSF029D07+ TTGTAGTCTTTTATGGAGATTTATTAGTTTACGAGGGTGAGTTTTTACCAACTTGATGTT
rJMFF027L01+ TTGTAGTCTTTTATGGAGATTTATTAGTTTACGAGGGTGAGTTTTTACCAACTTGATGTT
rJMFF025B15+ TTGTAGTCTTTTATGGAGATTTATTAGTTTACGAGGGTGAGTTTTTACCAACTTGATGTT
rJMFF019O19+ TTGTAGTCTTTTATGGAGATTTATTAGTTTACGAGGGTGAGTTTTTACCAACTTGATGTT
rJMFF050P01+ TTGTAGTCTTTTATGGAGATTTATTAGTTTACGAGGGTGAGTTTTTACCAACTTGATGTT
rJMFF051D19+ TTGTAGTCTTTTATGGAGATTTATTAGTTTACGAGGGTGAGTTTTTACCAACTTGATGTT
JMFN029I12+ TTGTAGTCTTTTATGGAGATTTATTAGTTTACGAGGGTGAGTTTTTACCAACTTGATGTT
rJMFF009E21+ TTGTAGTCTTTTATGGAGATTTATTAGTTTACGAGGGTGAGTTTTTACCAACTTGATGTT
rJMFF015C06+ TTGTAGTCTTTTATGGAGATTTATTAGTTTACGAGGGTGAGTTTTTACCAACTTGATGTT
rJMFF005H05+ TTGTAGTCTTTTATGGAGATTTATTAGTTTACGAGGGTGAGTTTTTACCAACTTGATGTT
rJMFF014N08+ TTGTAGTCTTTTATGGAGATTTATTAGTTTACGAGGGTGAGTTTTTACCAACTTGATGTT
JMFN029D07+ TTGTAGTCTTTTATGGAGATTTATTAGTTTACAAGGGTGAGTTTTTACCAACTTGATGTT
rJMFF046E06+ TTGTAGTCTTTTATGGAGATTTATTAGTTTACGAGGGTGAG---TTACCAACTTGATGTT
rJMFF030N22+ TTGTAGTCTTTTATGGAGATTTATTAGTTTACGAGGGTGAGTTTTTACCAACTTGATGTT
                      ____________________________________________________________
consensus TTGTAGTCTTTTATGGAGATTTATTAGTTTACGAGGGTGAGTTTTTACCAACTTGATGTT
 
. : . : . : . : . : . :
rJMFF023P23+ TCATCTTGACGTTGCTAGTACAAGGAT
rJMSF029D07+ TCATCTTGACGTTGCTAGTACAAGGATTTTTAATGATCTT
rJMFF027L01+ TCATCTTGACGTTGCTAGTACAAGGATTTTTAATGATCTTGATTTATT
rJMFF025B15+ TCATCTTGACGTTGCTAGTACAAGGA
rJMFF019O19+ TCATCTTGACGTTGCTAGTACAAGGATTTTTAATGATCTTGATTTATTT
rJMFF050P01+ TCATCTTGACGTTGCTAGTACAAGGATTTTTAATGA
rJMFF051D19+ TCATCTTGACGTTGCTAGTACAAGGATTTTTAATGATCTT
JMFN029I12+ TCATCTTGACGTTGCTAGTACAAGGATTTTTAATGATCTTGATTTATTTTGAATT
rJMFF009E21+ TCATCTTGACGTTGCTAGTACAAGGATTTTTAATGATCTTGATTTATTTTGAATTAAATA
rJMFF015C06+ TCATCTTGACGTTGCTAGTACAAGGATTTTTAATGATCTTGATTTATTTTGAATTAAATA
rJMFF005H05+ TCATCTTGACGTTGCTAGTACAAGGATTTTTAATGATCTTGATTTATTTTGAATTAAATA
rJMFF014N08+ TCATCTTGACGTTGCTAGTACAAGGATTTTTAATGATCTTGATTTATTTTGAATTAAATA
JMFN029D07+ TCATCTTGACGTTGCTAGTACAAGGATTTTTAATGATCTTGATTTATTTTGAATTAAATA
rJMFF046E06+ TCATCTTGACGTTGCTAGTACAAGGATTTTTAATGATCTTGATTTATTTTGAATTAAATA
rJMFF030N22+ TCATCTTGACGTTGCTAGTACAAGGATTTTTAATGATCTTGATTTATTTTGAATTAAATA
                      ____________________________________________________________
consensus TCATCTTGACGTTGCTAGTACAAGGATTTTTAATGATCTTGATTTATTTTGAATTAAATA
 
. : . : . : . : . : . :
rJMFF009E21+ GAAC
rJMFF015C06+ GAACC
rJMFF005H05+ GAACCC
rJMFF014N08+ GAACCCTTCGA
JMFN029D07+ GAACCCTTCGATTTTATTCTC
rJMFF046E06+ GAACCCTTCGATTTTATTCTC
rJMFF030N22+ GAACCCTTCGATTTTATTCTCATGAATCGTCGAGTATTTGCCGGTCTTGCATTTAATCAT
                      ____________________________________________________________
consensus GAACCCTTCGATTTTATTCTCATGAATCGTCGAGTATTTGCCGGTCTTGCATTTAATCAT