Previous Contig 009645:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001I05Sequence547007748 (15)pir|D96512|D965122e-28hypothetical protein F2G19.16 [imported] - Arabidopsis thaliana>gb:AE005173_8926794009645 (13)pir|B85072|B850721e-59hypothetical protein AT4g07400 [imported] - Arabidopsis thaliana>gb:ATCHRIV17_15
JMFF003E17Sequence486007748 (15)gb:AY220479_15905136e-19Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 189 (ACRE189) mRNA, complet689009645 (13)gb:AY220479_15905139e-41Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 189 (ACRE189) mRNA, complet
JMFF009F02Sequence556007748 (15)pir|D96512|D965127e-32hypothetical protein F2G19.16 [imported] - Arabidopsis thaliana>gb:AE005173_8926676009645 (13)gb:AY220479_15905139e-41Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 189 (ACRE189) mRNA, complet
JMFF012M14Sequence513007748 (15)gb:AY220479_15905134e-57Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 189 (ACRE189) mRNA, complet786009645 (13)pir|B85072|B850727e-53hypothetical protein AT4g07400 [imported] - Arabidopsis thaliana>gb:ATCHRIV17_15
JMFF023J03Sequence491007748 (15)gb:AY220479_15905131e-22Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 189 (ACRE189) mRNA, complet800009645 (13)pir|B85072|B850721e-60hypothetical protein AT4g07400 [imported] - Arabidopsis thaliana>gb:ATCHRIV17_15
JMFF030J16Sequence586007748 (15)pir|D96512|D965126e-39hypothetical protein F2G19.16 [imported] - Arabidopsis thaliana>gb:AE005173_8926696009645 (13)pir|B85072|B850722e-43hypothetical protein AT4g07400 [imported] - Arabidopsis thaliana>gb:ATCHRIV17_15
JMFF030N08Sequence512007748 (15)pir|D96512|D965126e-26hypothetical protein F2G19.16 [imported] - Arabidopsis thaliana>gb:AE005173_8926761009645 (13)
JMFF042C17Sequence620007748 (15)pir|D96512|D965125e-43hypothetical protein F2G19.16 [imported] - Arabidopsis thaliana>gb:AE005173_8926618009645 (13)gb:AY220479_15905139e-29Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 189 (ACRE189) mRNA, complet
JMFF044C08Sequence639007748 (15)pir|D96512|D965123e-42hypothetical protein F2G19.16 [imported] - Arabidopsis thaliana>gb:AE005173_8926652009645 (13)gb:AY220479_15905133e-25Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 189 (ACRE189) mRNA, complet
JMFF047A05Sequence472007748 (15)gb:AY220479_15905132e-20Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 189 (ACRE189) mRNA, complet416009645 (13)pir|T45861|T458610.018hypothetical protein F3A4.160 - Arabidopsis thaliana>gb:ATF3A4_1550562 Arabidops
JMFF049L07Sequence646007748 (15)pir|D96512|D965123e-42hypothetical protein F2G19.16 [imported] - Arabidopsis thaliana>gb:AE005173_8926650009645 (13)gb:AY220479_15905131e-20Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 189 (ACRE189) mRNA, complet
JMSF013E21Sequence208007748 (15)769009645 (13)pir|B85072|B850722e-59hypothetical protein AT4g07400 [imported] - Arabidopsis thaliana>gb:ATCHRIV17_15
JMSF046O03Sequence749007748 (15)gb:AY220479_15905139e-56Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 189 (ACRE189) mRNA, complet679009645 (13)pir|B85072|B850721e-44hypothetical protein AT4g07400 [imported] - Arabidopsis thaliana>gb:ATCHRIV17_15

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF012M14+ TGGATGGAAANCAAATAGGATAAGTGATGATGGGTT
rJMSF013E21+ TGGATGGAAAACAAATAGGATAAGTGATGATGGGTT
rJMFF001I05+ ATTGATGGATGGAAANCAAATAGGATAAGTGATGATGGGTT
rJMFF023J03+ AAGCTTCATATTGATGGATGGAAANCAAATAGGATAAGTGATGATGGGTT
                      ____________________________________________________________
consensus AAGCTTCATATTGATGGATGGAAAACAAATAGGATAAGTGATGATGGGTT
 
. : . : . : . : . : . :
rJMFF012M14+ GCTTGCTGTGGCAAAGCACTGCCCCCAATTTACAAGAATTGGTTTTGATTGGAGTGAATC
rJMSF013E21+ GCTTGCTGTGGCAAAGCACTG-CCCCAATTTACAAGAATTGGTTTTGATTGGAGTGAATC
rJMSF046O03+ GGAGTGAATC
rJMFF001I05+ GCTTGCTGTGGCAAAGCACTG-CCCCAATTTACAAGAATTGGTTTTGATTGGAGTGAATC
rJMFF030J16+ GAATC
rJMFF023J03+ GCTTGCTGTGGCAAAGCACTG-CCCCAATTTACAAGAATTGGTTTTGATTGGAGTGAATC
                      ____________________________________________________________
consensus GCTTGCTGTGGCAAAGCACTG-CCCCAATTTACAAGAATTGGTTTTGATTGGAGTGAATC
 
. : . : . : . : . : . :
rJMFF012M14+ CAACTCGAACTAGTTTAGAGAAACTGGCTACAAATTGTGTAAATTTAGAAAGGTTAGCTT
rJMSF013E21+ CAACTCGAACTAGTTTAGAGAAACTGGCTACAAATTGTGTAAATTTAGAAAGGTTAGCTT
rJMSF046O03+ CAACTCGAACTAGTTTAGAGAAACTGGCTACAAATTGTGTAAATTTAGAAAGGTTAGCTT
rJMFF001I05+ CAACTCGAACTAGTTTAGAGAAACTGGCTACAAATTGTGTAAATTTAGAAAGGTTAGCTT
rJMFF030J16+ CAACTCGAACTAGTTTAGAGAAACTGGCTACAAATTGTGTAAATTTAGAAAGGTTAGCTT
rJMFF009F02+ TAGAGAAACTGGCTACAAATTGTGTAAATTTAGAAAGGTTAGCTT
rJMFF023J03+ CAACTCGAACTAGTTTAGAGAAACTGGCTACAAATTGTGTAAATTTAGAAAGGTTAGCTT
rJMFF003E17+ GAGAAACTGGCTACAAATTGTGTAAATTTAGAAAGGTTAGCTT
                      ____________________________________________________________
consensus CAACTCGAACTAGTTTAGAGAAACTGGCTACAAATTGTGTAAATTTAGAAAGGTTAGCTT
 
. : . : . : . : . : . :
rJMFF012M14+ TGTGTGGGAGCGAGACTGTTGGTGACCCAGAGCTCTCCTGTATTGCTGCAAAATGCACTG
rJMSF013E21+ TGTGTGGGAGCGAGACTGTTGGTGACCCAGAGCTCTCCTGTATTGCTGCAAAATGCACTG
rJMSF046O03+ TGTGTGGGAGCGAGACTGTTGGTGACCCAGAGCTCTCCTGTATTGCTGCAAAATGCACTG
rJMFF001I05+ TGTGTGGGAGCGAGACTGTTGGTGACCCAGAGCTCTCCTGTATTGCTGCAAAATGCACTG
rJMFF030J16+ TGTGTGGGAGCGAGACTGTTGGTGACCCAGAGCTCTCCTGTATTGCTGCAAAATGCACTG
rJMFF009F02+ TGTGTGGGAGCGAGACTGTTGGTGACCCAGAGCTCTCCTGTATTGCTGCAAAATGCACTG
rJMFF023J03+ TGTGTGGGAGCGAGACTGTTGGTGACCCAGAGCTCTCCTGTATTGCTGCAAAATGCACTG
rJMFF003E17+ TGTGTGGGAGCGAGACTGTTGGTGACCCAGAGCTCTCCTGTATTGCTGCAAAATGCACTG
rJMFF042C17+ CTGTATTGCTGCAAAATGCACTG
rJMFF044C08+ TG
                      ____________________________________________________________
consensus TGTGTGGGAGCGAGACTGTTGGTGACCCAGAGCTCTCCTGTATTGCTGCAAAATGCACTG
 
. : . : . : . : . : . :
rJMFF012M14+ CATTGAAGAAACTTTGTATAAAGAGTTGCCCCGTGTCAGACCAGGGAATGGAAGCTCTTG
rJMSF013E21+ CATTGAAGAAACTTTGTATAAAGAGTTGCCCCGTGTCAGACCAGGGAATGGAAGCTCTTG
rJMSF046O03+ CATTGAAGAAACTTTGTATAAAGAGTTGCCCCGTGTCAGACCAGGGAATGGAAGCTCTTG
rJMFF001I05+ CATTGAAGAAACTTTGTATAAAGAGTTGCCCCGTGTCAGACCAGGGAATGGAAGCTCTTG
rJMFF030J16+ CATTGAAGAAACTTTGTATAAAGAGTTGCCCCGTGTCAGACCAGGGAATGGAAGCTCTTG
rJMFF009F02+ CATTGAAGAAACTTTGTATAAAGAGTTGCCCCGTGTCAGACCAGGGAATGGAAGCTCTTG
rJMFF023J03+ CATTGAAGAAACTTTGTATAAAGAGTTGCCCCGTGTCAGACCAGGGAATGGAAGCTCTTG
rJMFF003E17+ CATTGAAGAAACTTTGTATAAAGAGTTGCCCCGTGTCAGACCAGGGAATGGAAGCTCTTG
rJMFF042C17+ CATTGAAGAAACTTTGTATAAAGAGTTGCCCCGTGTCAGACCAGGGAATGGAAGCTCTTG
rJMFF044C08+ CATTGAAGAAACTTTGTATAAAGAGTTGCCCCGTGTCAGACCAGGGAATGGAAGCTCTTG
rJMFF049L07+ TGAAGAAACTTT-TATAAAGAGTGCNCCCGTGTCAGACCAGGGAATGGAAGCTCTTG
                      ____________________________________________________________
consensus CATTGAAGAAACTTTGTATAAAGAGTTGCCCCGTGTCAGACCAGGGAATGGAAGCTCTTG
 
. : . : . : . : . : . :
rJMFF012M14+ CCAGTGGGTGTCCAAACTTGATCAAGGTGAAGGTTAAGAAATGCAGATTGGTAACTACCG
rJMSF013E21+ CCAGTGGGTGTCCAAACTTGATCAAGGTGAAGGTTAAGAAATGCAGATTGGTAACTACCG
rJMSF046O03+ CCAGTGGGTGTCCAAACTTGATCAAGGTGAAGGTTAAGAAATGCAGATTGGTAACTACCG
rJMFF001I05+ CCAGTGGGTGTCCAAACTTGATCAAGGTGAAGGTTAAGAAATGCAGATTGGTAACTACCG
rJMFF030J16+ CCAGTGGGTGTCCAAACTTGATCAAGGTGAAGGTTAAGAAATGCAGATTGGTAACTACCG
rJMFF009F02+ CCAGTGGGTGTCCAAACTTGATCAAGGTGAAGGTTAAGAAATGCAGATTGGTAACTACCG
rJMFF023J03+ CCAGTGGGTGTCCAAACTTGATCAAGGTGAAGGTTAAGAAATGCAGATTGGTAACTACCG
rJMFF003E17+ CCAGTGGGTGTCCAAACTTGATCAAGGTGAAGGTTAAGAAATGCAGATTGGTAACTACCG
rJMFF042C17+ CCAGTGGGTGTCCAAACTTGATCAAGGTGAAGGTTAAGAAATGCAGATTGGTAACTACCG
rJMFF044C08+ CCAGTGGGTGTCCAAACTTGATCAAGGTGAAGGTTAAGAAATGCAGATTGGTAACTACCG
rJMFF049L07+ CCAGTGGGTGTCCAAACTTGATCAAGGTGAAGGTTAAGAAATGCAGATTGGTAACTACCG
                      ____________________________________________________________
consensus CCAGTGGGTGTCCAAACTTGATCAAGGTGAAGGTTAAGAAATGCAGATTGGTAACTACCG
 
. : . : . : . : . : . :
rJMFF012M14+ AGGGTGCAGATTGGTTGAGGGCAAGTAGGGGTTCCATTGCCGTGAATTTAGATACTACTG
rJMSF013E21+ AGGGTGCAGATTGGTTGAGGGCAAGTAGGGGTTCCATTGCCGTGAATTTAGATACTACTG
rJMSF046O03+ AGGGTGCAGATTGGTTGAGGGCAAGTAGGGGTTCCATTGCCGTGAATTTAGATACTACTG
rJMFF001I05+ AGGGTGCAGATTGGTTGAGGGCAAGTAGGGGTTCCATTGCCGTGAATTTAGATACTACTG
rJMFF030J16+ AGGGTGCAGATTGGTTGAGGGCAAGTAGGGGTTCCATTGCCGTGAATTTAGATACTACTG
rJMFF009F02+ AGGGTGCAGATTGGTTGAGGGCAAGTAGGGGTTCCATTGCCGTGAATTTAGATACTACTG
rJMFF023J03+ AGGGTGCAGATTGGTTGAGGGCAAGTAGGGGTTCCATTGCCGTGAATTTAGATACTACTG
rJMFF003E17+ AGGGTGCAGATTGGTTGAGGGCAAGTAGGGGTTCCATTGCCGTGAATTTAGATACTACTG
rJMFF047A05+ CTG
rJMFF042C17+ AGGGTGCAGATTGGTTGAGGGCAAGTAGGGGTTCCATTGCCGTGAATTTAGATACTACTG
rJMFF044C08+ AGGGTGCAGATTGGTTGAGGGCAAGTAGGGGTTCCATTGCCGTGAATTTAGATACTACTG
rJMFF049L07+ AGGGTGCAGATTGGTTGAGGGCAAGTAGGGGTTCCATTGCCGTGAATTTAGATACTACTG
                      ____________________________________________________________
consensus AGGGTGCAGATTGGTTGAGGGCAAGTAGGGGTTCCATTGCCGTGAATTTAGATACTACTG
 
. : . : . : . : . : . :
rJMFF012M14+ AGTTGGAGAATCCTGATGGGGCTGCTAGTGATGGTGGTGCCCCTGAAGTTGGCCAGGAGA
rJMSF013E21+ AGTTGGAGAATCCTGATGGGGCTGCTAGTGATGGTGGTGCCCCTGAAGTTGGCCAGGAGA
rJMSF046O03+ AGTTGGAGAATCCTGATGGGGCTGCTAGTGATGGTGGTGCCCCTGAAGTTGGCCAGGAGA
rJMFF001I05+ AGTTGGAGAATCCTGATGGGGCTGCTAGTGATGGTGGTGCCCCTGAAGTTGGCCAGGAGA
rJMFF030J16+ AGTTGGAGAATCCTGATGGGGCTGCTAGTGATGGTGGTGCCCCTGAAGTTGGCCAGGAGA
rJMFF009F02+ AGTTGGAGAATCCTGATGGGGCTGCTAGTGATGGTGGTGCCCCTGAAGTTGGCCAGGAGA
rJMFF023J03+ AGTTGGAGAATCCTGATGGGGCTGCTAGTGATGGTGGTGCCCCTGAAGTTGGCCAGGAGA
rJMFF003E17+ AGTTGGAGAATCCTGATGGGGCTGCTAGTGATGGTGGTGCCCCTGAAGTTGGCCAGGAGA
rJMFF047A05+ AGTTGGAGAATCCTGATGGGGCTGCTAGTGATGGTGGTGCCCNTGAAGTTGGCCAGGAGA
rJMFF042C17+ AGTTGGAGAATCCTGATGGGGCTGCTAGTGATGGTGGTGCCCCTGAAGTTGGCCAGGAGA
rJMFF044C08+ AGTTGGAGAATCCTGATGGGGCTGCTAGTGATGGTGGTGCCCCTGAAGTTGGCCAGGAGA
rJMFF049L07+ AGTTGGAGAATCCTGATGGGGCTGCTAGTGATGGTGGTGCCCCTGAAGTTGGCCAGGAGA
                      ____________________________________________________________
consensus AGTTGGAGAATCCTGATGGGGCTGCTAGTGATGGTGGTGCCCCTGAAGTTGGCCAGGAGA
 
. : . : . : . : . : . :
rJMFF012M14+ ATCGGCAGTTGGGTGGCCAAGATGGCAGTGGTAGTATTGCATCAAGCAGTAATGGAAGAT
rJMSF013E21+ ATCGGCAGTTGGGTGGCCAAGATGGCAGTGGTAGTATTGCATCAAGCAGTAATGGAAGAT
rJMSF046O03+ ATCGGCAGTTGGGTGGCCAAGATGGCAGTGGTAGTATTGCATCAAGCAGTAATGGAAGAT
rJMFF001I05+ ATCGGCAGTTGGGTGGCCAAGATGGCAGTGGTAGTATTGCATCAAGCAGTAATGGAAGAT
rJMFF030J16+ ATCGGCAGTTGGGTGGCCAAGATGGCAGTGGTAGTATTGCATCAAGCAGTAATGGAAGAT
rJMFF009F02+ ATCGGCAGTTGGGTGGCCAAGATGGCAGTGGTAGTATTGCATCAAGCAGTAATGGAAGAT
rJMFF023J03+ ATCGGCAGTTGGGTGGCCAAGATGGCAGTGGTAGTATTGCATCAAGCAGTAATGGAAGAT
rJMFF003E17+ ATCGGCAGTTGGGTGGCCAAGATGGCAGTGGTAGTATTGCATCAAGCAGTAATGGAAGAT
rJMFF047A05+ ATCGGCAGTTGGGTGGCCAAGATGGCAGTGGTAGTATTGCATCAAGCAGTAATGGAAGAT
rJMFF042C17+ ATCGGCAGTTGGGTGGCCAAGATGGCAGTGGTAGTATTGCATCAAGCAGTAATGGAAGAT
rJMFF044C08+ ATCGGCAGTTGGGTGGCCAAGATGGCAGTGGTAGTATTGCATCAAGCAGTAATGGAAGAT
rJMFF049L07+ ATCGGCAGTTGGGTGGCCAAGATGGCAGTGGTAGTATTGCATCAAGCAGTAATGGAAGAT
rJMFF030N08+ CCAAGATGNCAGTGGTAGTATTGCATCAAGCAGTAATGGAAGAT
                      ____________________________________________________________
consensus ATCGGCAGTTGGGTGGCCAAGATGGCAGTGGTAGTATTGCATCAAGCAGTAATGGAAGAT
 
. : . : . : . : . : . :
rJMFF012M14+ CAACCTCCTTCAAAGCAAGGTTAGGGCTTATTACAGGGCGGAATTTGGTTGCGTGCACAT
rJMSF013E21+ CAACCTCCTTCAAAGCAAGGTTAGGGCTTATTACAGGGCGGAATTTGGTTGCGTGCACAT
rJMSF046O03+ CAACCTCCTTCAAAGCAAGGTTAGGGCTTATTACAGGGCGGAATTTGGTTGCGTGCACAT
rJMFF001I05+ CAACCTCCTTCAAAGCAAGGTTAGGGCTTATTACAGGGCGGAATTTGGTTGCGTGCACAT
rJMFF030J16+ CAACCTCCTTCAAAGCAAGGTTAGGGCTTATTACAGGGCGGAATTTGGTTGCGTGCACAT
rJMFF009F02+ CAACCTCCTTCAAAGCAAGGTTAGGGCTTATTACAGGGCGGAATTTGGTTGCGTGCACAT
rJMFF023J03+ CAACCTCCTTCAAAGCAAGGTTAGGGCTTATTACAGGGCGGAATTTGGTTGCGTGCACAT
rJMFF003E17+ CAACCTCCTTCAAAGCAAGGTTAGGGCTTATTACAGGGCGGAATTTGGTTGCGTGCACAT
rJMFF047A05+ CAACCTCCTTCAAAGCAAGGTTAGGGCTTATTACAGGGCGGAATTTGGTTGCGTGCACAT
rJMFF042C17+ CAACCTCCTTCAAAGCAAGGTTAGGGCTTATTACAGGGCGGAATTTGGTTGCGTGCACAT
rJMFF044C08+ CAACCTCCTTCAAAGCAAGGTTAGGGCTTATTACAGGGCGGAATTTGGTTGCGTGCACAT
rJMFF049L07+ CAACCTCCTTCAAAGCAAGGTTAGGGCTTATTACAGGGCGGAATTTGGTTGCGTGCACAT
rJMFF030N08+ CACCCTCCTTCAAAGCAAGGTTAGGGCTTATTACAGGGCGGAATTTGGTTGCGTGCACAT
                      ____________________________________________________________
consensus CAACCTCCTTCAAAGCAAGGTTAGGGCTTATTACAGGGCGGAATTTGGTTGCGTGCACAT
 
. : . : . : . : . : . :
rJMFF012M14+ TCAGAAGGTGGTCAAGCTTTGGTGGAAATTCCAGGAATAATTAGACAAAGGAACTGGTTG
rJMSF013E21+ TCAGAAGGTGGTCAAGCTTTGGTGGAAATTCCAGGAATAATTAGACAAAGGAACTGGTTG
rJMSF046O03+ TCAGAAGGTGGTCAAGCTTTGGTGGAAATTCCAGGAATAATTAGACAAAGGAACTGGTTG
rJMFF001I05+ TCAGAAGGTGGTCAAGCTTTGGTGGAAATTCCAGGAATAATTAGACAAAGGAACTGGTTG
rJMFF030J16+ TCAGAAGGTGGTCAAGCTTTGGTGGAAATTCCAGGAATAATTAGACAAAGGAACTGGTTG
rJMFF009F02+ TCAGAAGGTGGTCAAGCTTTGGTGGAAATTCCAGGAATAATTAGACAAAGGAACTGGTTG
rJMFF023J03+ TCAGAAGGTGGTCAAGCTTTGGTGGAAATTCCAGGAATAATTAGACAAAGGAACTGGTTG
rJMFF003E17+ TCAGAAGGTGGTCAAGCTTTGGTGGAAATTCCAGGAATAATTAGACAAAGGAACTGGTTG
rJMFF047A05+ TCAGAAGGTGGTCAAGCTTTGGTGGAAATTCCAGGAATAATTAGACAAAGGAACTGGTTG
rJMFF042C17+ TCAGAAGGTGGTCAAGCTTTGGTGGAAATTCCAGGAATAATTAGACAAAGGAACTGGTTG
rJMFF044C08+ TCAGAAGGTGGTCAAGCTTTGGTGGAAATTCCAGGAATAATTAGACAAAGGAACTGGTTG
rJMFF049L07+ TCAGAAGGTGGTCAAGCTTTGGTGGAAATTCCAGGAATAATTAGACAAAGGAACTGGTTG
rJMFF030N08+ TCAGAAGGTGGTCAAGCTTTGGTGGAAATTCCAGGAATAATTAGACAAAGGAACTGGTTG
                      ____________________________________________________________
consensus TCAGAAGGTGGTCAAGCTTTGGTGGAAATTCCAGGAATAATTAGACAAAGGAACTGGTTG
 
. : . : . : . : . : . :
rJMFF012M14+ ATTTGGAGTGGAGAACAACACTTCTGATCTATTCAAATTGTTTTGTGTTGTAGTGATTTT
rJMSF013E21+ ATTTGGAGTGGAGAACAACACTTCTGATCTATTCAAATTGTTTTGTGTTGTAGTGATTTT
rJMSF046O03+ ATTTGGAGTGGAGAACAACACTTCTGATCTATTCAAATTGTTTTGTGTTGTAGTGATTTT
rJMFF001I05+ ATTTGGAGTGGAGAACAACACTTCTGATCTATTCAAATTGTTTTGTGTTGTAGTGATTTT
rJMFF030J16+ ATTTGGAGTGGAGAACAACACTTCTGATCTATTCAAATTGTTTTGTGTTGTAGTGATTTT
rJMFF009F02+ ATTTGGAGTGGAGAACAACACTTCTGATCTATTCAAATTGTTTTGTGTTGTAGTGATTTT
rJMFF023J03+ ATTTGGAGTGGAGAACAACACTTCTGATCTATTCAAATTGTTTTGTGTTGTAGTGATTTT
rJMFF003E17+ ATTTGGAGTGGAGAACAACACTTCTGATCTATTCAAATTGTTTTGTGTTGTAGTGATTTT
rJMFF047A05+ ATTTGGAGTGGAGAACAACACTTCTGATCTATTCAAATTGTTTTGTGTTGTAGTGATTTT
rJMFF042C17+ ATTTGGAGTGGAGAACAACACTTCTGATCTATTCAAATTGTTTTGTGTTGTAGTGATTTT
rJMFF044C08+ ATTTGGAGTGGAGAACAACACTTCTGATCTATTCAAATTGTTTTGTGTTGTAGTGATTTT
rJMFF049L07+ ATTTGGAGTGGAGAACAACACTTCTGATCTATTCAAATTGTTTTGTGTTGTAGTGATTTT
rJMFF030N08+ ATTTGGAGTGGAGAACAACACTTCTGATCTATTCAAATTGTTTTGTGTTGTAGTGATTTT
                      ____________________________________________________________
consensus ATTTGGAGTGGAGAACAACACTTCTGATCTATTCAAATTGTTTTGTGTTGTAGTGATTTT
 
. : . : . : . : . : . :
rJMFF012M14+ CTGTTTGTCTTTGTGTTTCTAATTTGGCTGCTCTGTTTTAATGCCTTCCATAGATTACAT
rJMSF013E21+ CTGTTTGTCTTTGTGTTTCTAATTTGGCTGCTCTGTTTTAATGCCTTCCATAGATTACAT
rJMSF046O03+ CTGTTTGTCTTTGTGTTTCTAATTTGGCTGCTCTGTTTTAATGCCTTCCATAGATTACAT
rJMFF001I05+ CTGTTTGTCTTTGTGTTTCTAATTTGGCTGCTCTGTTTTAATGCCTTCCATAGATTACAT
rJMFF030J16+ CTGTTTGTCTTTGTGTTTCTAATTTGGCTGCTCTGTTTTAATGCCTTCCATAGATTACAT
rJMFF009F02+ CTGTTTGTCTTTGTGTTTCTAATTTGGCTGCTCTGTTTTAATGCCTTCCATAGATTACAT
rJMFF023J03+ CTGTTTGTCTTTGTGTTTCTAATTTGGCTGCTCTGTTTTAATGCCTTCCATAGATTACAT
rJMFF003E17+ CTGTTTGTCTTTGTGTTTCTAATTTGGCTGCTCTGTTTTAATGCCTTCCATAGATTACAT
rJMFF047A05+ CTGTTTGTCTTTGTGTTTCTAATTTGGCTGCTCTGTTTTAATGCCTTCCATAGATTACAT
rJMFF042C17+ CTGTTTGTCTTTGTGTTTCTAATTTGGCTGCTCTGTTTTAATGCCTTCCATAGATTACAT
rJMFF044C08+ CTGTTTGTCTTTGTGTTTCTAATTTGGCTGCTCTGTTTTAATGCCTTCCATAGATTACAT
rJMFF049L07+ CTGTTTGTCTTTGTGTTTCTAATTTGGCTGCTCTGTTTTAATGCCTTCCATAGATTACAT
rJMFF030N08+ CTGTTTGTCTTTGTGTTTCTAATTTGGCTGCTCTGTTTTAATGCCTTCCATAGATTACAT
                      ____________________________________________________________
consensus CTGTTTGTCTTTGTGTTTCTAATTTGGCTGCTCTGTTTTAATGCCTTCCATAGATTACAT
 
. : . : . : . : . : . :
rJMFF012M14+ TTTTATGTGTGGAAGTCTGATTCTATAACA
rJMSF013E21+ TTTTATGTG
rJMSF046O03+ TTTTATGTG
rJMFF001I05+ TTTTATGTGTGGAAGTCTGATTCTATAACA
rJMFF030J16+ TTTTATGTGTGGAAGTCTGATTCTATAACAT
rJMFF009F02+ TTTTATGTGTGGAAGTCTGATTCTATAACA
rJMFF023J03+ TTTTATGTGTGGAAGTCTGATTCTATAACAT
rJMFF003E17+ TTTTATGTGTGGAAGTCTGATTCTATAACATGTCTGAAATAGTGCT
rJMFF047A05+ TTTTATGTGTGGAAGTCTGATTCTATAACATGTCTGAAATAGTGCTTTGTTCT
rJMFF042C17+ TTTTATGTGTGGAAGTCTGATTCTATAACATGTCTGAAATAGTGCTTTGTTCTTC
rJMFF044C08+ TTTTATGTGTGGAAGTCTGATTCTATAACATGTCTGAAATAGTGCTTTGTTCTTCACTGT
rJMFF049L07+ TTTTATGTGTGGAAGTCTGATTCTATAACATGTCTGAAATAGTGCTTTGTTCTTCACTGT
rJMFF030N08+ TTTTATGTGTGGAAGTCTGATTCTATAACATGTCTGAAATAGTGCTTTGTTCTTCACTGT
                      ____________________________________________________________
consensus TTTTATGTGTGGAAGTCTGATTCTATAACATGTCTGAAATAGTGCTTTGTTCTTCACTGT
 
. : . : . : . : . : . :
rJMFF044C08+ GTGCTACCCAAAA
rJMFF049L07+ GTGCTACCCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
rJMFF030N08+ GTGCTACCCAAAATGCTAGACTGAT---AACAGTTGAATGGGGAATAGGTTGTTGCTGTT
                      ____________________________________________________________
consensus GTGCTACCCAAAATGCTAGACTGATCTCTCCAGTTTGATGGGGCATAGGTTGTTGCTGTT
 
. : . : . : . : . : . :
rJMFF030N08+ CTTTAATCACTTGGGAAAAACTAATTTGCAATGTGGAATTCTTCTGTCACACAGCCAAGA
                      ____________________________________________________________
consensus CTTTAATCACTTGGGAAAAACTAATTTGCAATGTGGAATTCTTCTGTCACACAGCCAAGA
 
. : . : . : . : . : . :
rJMFF030N08+ GGAATATCAGCACTCTTCTAGCAATGATAGACAACAGAGAAACTTCCTCTTTTCAAATCT
                      ____________________________________________________________
consensus GGAATATCAGCACTCTTCTAGCAATGATAGACAACAGAGAAACTTCCTCTTTTCAAATCT
 
. : . : . : . : . : . :
rJMFF030N08+ CTATATTCTATGCTCCGATTTTCAGCATGATCTGGATTTAATGCGTATGACTGTCTTCTT
                      ____________________________________________________________
consensus CTATATTCTATGCTCCGATTTTCAGCATGATCTGGATTTAATGCGTATGACTGTCTTCTT
 
. : . : . : . : . : . :
rJMFF030N08+ GTCCTCGTAGCTGTATATCTTATATTTAATTGCTGTCTATAGTTTCTGCTGCCTGGTAAG
                      ____________________________________________________________
consensus GTCCTCGTAGCTGTATATCTTATATTTAATTGCTGTCTATAGTTTCTGCTGCCTGGTAAG
 
. : . : . : . : . : . :
rJMFF030N08+ CCAGCCTGCAATGTTAATTTTATTTCTCCAATATCTTGGAGGGATGTAAAAATGCCATTT
                      ____________________________________________________________
consensus CCAGCCTGCAATGTTAATTTTATTTCTCCAATATCTTGGAGGGATGTAAAAATGCCATTT
 
. : . : . : . : . : . :
rJMFF030N08+ TGAATGGTGTTTGCTTATAGGTTTGATACTTGCATCCAGTGCATAGGAATCTGTTATCTT
                      ____________________________________________________________
consensus TGAATGGTGTTTGCTTATAGGTTTGATACTTGCATCCAGTGCATAGGAATCTGTTATCTT