Previous Contig 009642:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015E09Sequence539009642 (8)gb:AY097387_15763821e-20Arabidopsis thaliana AT5g49210/K21P3_8 mRNA, complete cds.>gb:AF411800_1797264 A713009642 (8)gb:AY097387_15763822e-24Arabidopsis thaliana AT5g49210/K21P3_8 mRNA, complete cds.>gb:AF411800_1797264 A
JMFF030K24Sequence536009642 (8)gb:AY097387_15763827e-17Arabidopsis thaliana AT5g49210/K21P3_8 mRNA, complete cds.>gb:AF411800_1797264 A662009642 (8)gb:AY097387_15763827e-24Arabidopsis thaliana AT5g49210/K21P3_8 mRNA, complete cds.>gb:AF411800_1797264 A
JMFN008P11Sequence611009642 (8)gb:AY097387_15763829e-26Arabidopsis thaliana AT5g49210/K21P3_8 mRNA, complete cds.>gb:AF411800_1797264 A
JMSF024A06Sequence662009642 (8)gb:AY097387_15763823e-25Arabidopsis thaliana AT5g49210/K21P3_8 mRNA, complete cds.>gb:AF411800_1797264 A722009642 (8)gb:AY097387_15763824e-25Arabidopsis thaliana AT5g49210/K21P3_8 mRNA, complete cds.>gb:AF411800_1797264 A
JMSF024A07Sequence609009642 (8)gb:AY097387_15763824e-24Arabidopsis thaliana AT5g49210/K21P3_8 mRNA, complete cds.>gb:AF411800_1797264 A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF030K24- ATCTCTGCTCGCTAGGGTTTTATCGATCTGAGCAGCGGCATTACCTTTCAACCA
JMSF024A06- GAGCAGCGGCATTACCTTTCAACCA
JMFN008P11- TTCAACCA
JMFF015E09- AACCA
rJMSF024A06+ GAGCAGCGGCATTACCTTTCAACCA
                      ____________________________________________________________
consensus ATCTCTGCTCGCTAGGGTTTTATCGATCTGAGCAGCGGCATTACCTTTCAACCA
 
. : . : . : . : . : . :
JMFF030K24- AATGTCGCTCTCCCGGCATCTTCTTCGGAACCCCATTTCCACCCAAACCCTAAAGCTCCA
JMSF024A06- AATGTCGCTCTCCCGGCATCTTCTTCGGAACCCCATTTCCACCCAAGCCCTAAAGCTCCA
JMFN008P11- AATGTCGCTCTCCCGGTATCTTCTTCGGAACCCCATTTCCACCCAAGCCCTAAAGCTCCA
JMFF015E09- AATGTCGCTCTCCCGGCATCTTCTTCGGAACCCCATTTCCACCCAAGCCCTAAAGCTCCA
rJMSF024A06+ AATGTCGCTCTCCCGGCATCTTCTTCGGAACCCCATTTCCACCCAAGCCCTAAAGCTCCA
rJMFF015E09+ TAAAGCTCCA
                      ____________________________________________________________
consensus AATGTCGCTCTCCCGGCATCTTCTTCGGAACCCCATTTCCACCCAAGCCCTAAAGCTCCA
 
. : . : . : . : . : . :
JMFF030K24- CCATCTCCGATCGCTTT-CCGCCACCGCCGAAACCCAGGCGGCGTTGGAGAAGAATCTCC
JMSF024A06- CCATCTCCGATCGCTTT-CCGCCACCGCCGAAACCCAGGCGGCGTTGGAGAAGAATCTCC
JMFN008P11- CCATCTCCGATCGCTTT-CCGCCACCGCCGAAACCCAGGCGGCGTTGGAGAAGAATCTCC
JMFF015E09- CCATCTCCGATCGCTTT-CCGCCACCGCCGAAACCCAGGCGGCGTTGGAGAAGAATCTCC
rJMSF024A06+ CCATCTCCGATCGCTTT-CCGCCACCGCCGAAACCCAGGCGGCGTTGGAGAAGAATCTCC
rJMSF024A07+ CGATCGCTTTCCCGCCACCNCCGAAACCCAGGCGGCGTTGGAGAAGAATCTCC
rJMFF015E09+ CCATCTCCGATCGCTTT-CCGCCACCGCCGAAACCCAGGCGGCGTTGGAGAAGAATCTCC
rJMFF030K24+ CC
                      ____________________________________________________________
consensus CCATCTCCGATCGCTTT-CCGCCACCGCCGAAACCCAGGCGGCGTTGGAGAAGAATCTCC
 
. : . : . : . : . : . :
JMFF030K24- ACCAGCAGAGCCACAAATTCCTGGCGCCGAGCGAGTACCTGAACTCGTGGAAGCCCCCGA
JMSF024A06- ACCAGCAGAGCCACAAATTCCTGGCGCCGAGCGAGTACCTGAACTCGTGGAAGCCCCCGA
JMFN008P11- ACCAGCAGAGCCACAAATTCCTGGCGCCGAGCGAGTACCTGAACTCGTGGAAGCCCCCGA
JMFF015E09- ACCAGCAGAGCCACAAATTCCTGGCGCCGAGCGAGTACCTGAACTCGTGGAAGCCCCCGA
rJMSF024A06+ ACCAGCAGAGCCACAAATTCCTGGCGCCGAGCGAGTACCTGAACTCGTGGAAGCCCCCGA
rJMSF024A07+ ACCAGCAGAGCCACAAATTCCTGGCGCCGAGCGAGTACCTGAACTCGTGGAAGCCCCCGA
rJMFF015E09+ ACCAGCAGAGCCACAAATTCCTGGCGCCGAGCGAGTACCTGAACTCGTGGAAGCCCCCGA
rJMFF030K24+ ACCAGCAGAGCCACAAATTCCTGGCGCCGAGCGAGTACCTGAACTCGTGGAAGCCCCCGA
                      ____________________________________________________________
consensus ACCAGCAGAGCCACAAATTCCTGGCGCCGAGCGAGTACCTGAACTCGTGGAAGCCCCCGA
 
. : . : . : . : . : . :
JMFF030K24- GGGATCCCAAGGAGGCGGAAGCCCAGCTCGCGCTTCTCCGCCGCGAGTATGCCAAGAAGG
JMSF024A06- GGGATCCCAAGGAGGCGGAAGCCCAGCTCGCGCTTCTCCGCCGCGAGTATGCCAAGAAGG
JMFN008P11- GGGATCCCAAGGAGGCGGAAGCCCAGCTCGCGCTTCTCCGCCGCGAGTATGCCAAGAAGG
JMFF015E09- GGGATCCCAAGGAGGCGGAAGCCCAGCTCGCGCTTCTCCGCCGCGAGTATGCCAAGAAGG
rJMSF024A06+ GGGATCCCAAGGAGGCGGAAGCCCAGCTCGCGCTTCTCCGCCGCGAGTATGCCAAGAAGG
rJMSF024A07+ GGGATCCCAAGGAGGCGGAAGCCCAGCTCGCGCTTCTCCGCCGCGAGTATGCCAAGAAGG
rJMFF015E09+ GGGATCCCAAGGAGGCGGAAGCCCAGCTCGCGCTTCTCCGCCGCGAGTATGCCAAGAAGG
rJMFF030K24+ GGGATCCCAAGGAGGCGGAAGCCCAGCTCGCGCTTCTCCGCCGCGAGTATGCCAAGAAGG
                      ____________________________________________________________
consensus GGGATCCCAAGGAGGCGGAAGCCCAGCTCGCGCTTCTCCGCCGCGAGTATGCCAAGAAGG
 
. : . : . : . : . : . :
JMFF030K24- TCAAGGTGGTCCGCAAGGATTACATCAAGGAGATGGAGGTCCTGCGGCTCGAAAAGCTGA
JMSF024A06- TCAAGGTGGTCCGCAAGGATTACATCAAGGAGATGGAGGTCCTGCGGCTCGAAAAGCTGA
JMFN008P11- TCAAGGTGGTCCGCAAGGATTACATCAAGGAGATGGAGGTCCTGCGGCTCGAAAAGCTGA
JMFF015E09- TCAAGGTGGTCCGCAAGGATTACATCAAGGAGATGGAGGTCCTGCGGCTCGAAAAGCTGA
rJMSF024A06+ TCAAGGTGGTCCGCAAGGATTACATCAAGGAGATGGAGGTCCTGCGGCTCGAAAAGCTGA
rJMSF024A07+ TCAAGGTGGTCCGCAAGGATTACATCAAGGAGATGGAGGTCCTGCGGCTCGAAAAGCTGA
rJMFF015E09+ TCAAGGTGGTCCGCAAGGATTACATCAAGGAGATGGAGGTCCTGCGGCTCGAAAAGCTGA
rJMFF030K24+ TCAAGGTGGTCCGCAAGGATTACATCAAGGAGATGGAGGTCCTGCGGCTCGAAAAGCTGA
                      ____________________________________________________________
consensus TCAAGGTGGTCCGCAAGGATTACATCAAGGAGATGGAGGTCCTGCGGCTCGAAAAGCTGA
 
. : . : . : . : . : . :
JMFF030K24- GAAAAGCCGAGGCCAAGAAGGAAGCTTTGAGGATCGCAAATGAGGAGCGGAAGGCTGCTA
JMSF024A06- GAAAAGCCGAGGCCAAGAAGGAAGCTTTGAGGATCGCAAATGAGGAGCGGAAGGCTGCTA
JMFN008P11- GAAAAGCCGAGGCCAAGAAGGAAGCTTTGAGGATCGCAAATGAGGAGCGGAAGGCTGCTA
JMFF015E09- GAAAAGCCGAGGCCAAGAAGGAAGCTTTGAGGATCGCAAATGAGGAGCGGAAGGCTGCTA
rJMSF024A06+ GAAAAGCCGAGGCCAAGAAGGAAGCTTTGAGGATCGCAAATGAGGAGCGGAAGGCTGCTA
rJMSF024A07+ GAAAAGCCGAGGCCAAGAAGGAAGCTTTGAGGATCGCAAATGAGGAGCGGAAGGCTGCTA
rJMFF015E09+ GAAAAGCCGAGGCCAAGAAGGAAGCTTTGAGGATCGCAAATGAGGAGCGGAAGGCTGCTA
rJMFF030K24+ GAAAAGCCGAGGCCAAGAAGGAAGCTTTGAGGATCGCAAATGAGGAGCGGAAGGCTGCTA
                      ____________________________________________________________
consensus GAAAAGCCGAGGCCAAGAAGGAAGCTTTGAGGATCGCAAATGAGGAGCGGAAGGCTGCTA
 
. : . : . : . : . : . :
JMFF030K24- AAGCCGCTGAGAAGAAGGCCAAGGCTGAAGAGATAGCCATCTTTGAAGAGGAATTCCGCC
JMSF024A06- AAGCCGCTGAGAAGAAGGCCAAGGCTGAAGAGATAGCCATCTTTGAAGAGGAATTCCGCC
JMFN008P11- AAGCCGCTGAGAAGAAGGCCAAGGCTGAAGAGATAGCCATCTTTGAAGAGGAATTCCGCC
JMFF015E09- AAGCCGCTGAGAAGAAGGCCAAGGCTGAAGAGATAGCCATCTTTGAAGAGGAATTCCGCC
rJMSF024A06+ AAGCCGCTGAGAAGAAGGCCAAGGCTGAAGAGATAGCCATCTTTGAAGAGGAATTCCGCC
rJMSF024A07+ AAGCCGCTGAGAAGAAGGCCAAGGCTGAAGAGATAGCCATCTTTGAAGAGGAATTCCGCC
rJMFF015E09+ AAGCCGCTGAGAAGAAGGCCAAGGCTGAAGAGATAGCCATCTTTGAAGAGGAATTCCGCC
rJMFF030K24+ AAGCCGCTGAGAAGAAGGCCAAGGCTGAAGAGATAGCCATCTTTGAAGAGGAATTCCGCC
                      ____________________________________________________________
consensus AAGCCGCTGAGAAGAAGGCCAAGGCTGAAGAGATAGCCATCTTTGAAGAGGAATTCCGCC
 
. : . : . : . : . : . :
JMFF030K24- GAACTCTCCTAAAAGAAAGACAAGAGAAGCTTGAATACTGGAGGATGAGAGAAACTAAAA
JMSF024A06- GAACTCTCCTAAAAGAAAGACAAGAGAAGCTTGAATACTGGAGGATGAGAGAAACTAAAA
JMFN008P11- GAACTCTCCTAAAAGAAAGACAAGAGAAGCTTGAATACTGGAGGATGAGAGAAACTAAAA
JMFF015E09- GAACTCTCCTAAAAGAAAGACAAGAGAAGCTTGAATACTGGAGGATGAGAGAAACTAAAA
rJMSF024A06+ GAACTCTCCTAAAAGAAAGACAAGAGAAGCTTGAATACTGGAGGATGAGAGAAACTAAAA
rJMSF024A07+ GAACTCTCCTAAAAGAAAGACAAGAGAAGCTTGAATACTGGAGGATGAGAGAAACTAAAA
rJMFF015E09+ GAACTCTCCTAAAAGAAAGACAAGAGAAGCTTGAATACTGGAGGATGAGAGAAACTAAAA
rJMFF030K24+ GAACTCTCCTAAAAGAAAGACAAGAGAAGCTTGAATACTGGAGGATGAGAGAAACTAAAA
                      ____________________________________________________________
consensus GAACTCTCCTAAAAGAAAGACAAGAGAAGCTTGAATACTGGAGGATGAGAGAAACTAAAA
 
. : . : . : . : . : . :
JMFF030K24- TTA
JMSF024A06- TTAAAGAAAAGAAGACAAAGGGGAATGAGCTTTTGCGTCGAAAAAGTTCGTTGTGGATTG
JMFN008P11- TTAAAGAAAAGAAGACAAAGGGGAATGAGCTTTTGCGTCGAAAAAGTTCGTTGTGGATTG
JMFF015E09- TTAAAGAAAAGAAGACAAAGGGGAATGAGCTTTTGCGTCGAAAAAGTTCGTTGTG
rJMSF024A06+ TTAAAGAAAAGAAGACAAAGGGGAATGAGCTTTTGCGTCGAAAAAGTTCGTTGTGGATTG
rJMSF024A07+ TTAAAGAAAAGAAGACAAAGGGGAATGAGCTTTTGCGTCGAAAAAGTTCGTTGTGGATTG
rJMFF015E09+ TTAAAGAAAAGAAGACAAAGGGGAATGAGCTTTTGCGTCGAAAAAGTTCGTTGTGGATTG
rJMFF030K24+ TTAAAGAAAAGAAGACAAAGGGGAATGAGCTTTTGCGTCGAAAAAGTTCGTTGTGGATTG
                      ____________________________________________________________
consensus TTAAAGAAAAGAAGACAAAGGGGAATGAGCTTTTGCGTCGAAAAAGTTCGTTGTGGATTG
 
. : . : . : . : . : . :
JMSF024A06- ATGAGGAGGACCTGGAGGCCAAGTTACTTGATGCCTCCTGTAAACCCACTCCCCTCTGAA
JMFN008P11- ATGAGGAGGACCTGGAGGCCAAGTTACTTGATGCCTCCTGTAAACCCACTCCCCTCTGAA
rJMSF024A06+ ATGAGGAGGACCTGGAGGCCAAGTTACTTGATGCCTCCTGTAAACCCACTCCCCTCTGAA
rJMSF024A07+ ATGAGGAGGACCTGGAGGCCAAGTTACTTGATGCCTCCTGTAAACCCACTCCCCTCTGAA
rJMFF015E09+ ATGAGGAGGACCTGGAGGCCAAGTTACTTGATGCCTCCTGTAAACCCACTCCCCTCTGAA
rJMFF030K24+ ATGAGGAGGACCTGGAGGCCAAGTTACTTGATGCCTCCTGTAAACCCACTCCCCTCTGAA
                      ____________________________________________________________
consensus ATGAGGAGGACCTGGAGGCCAAGTTACTTGATGCCTCCTGTAAACCCACTCCCCTCTGAA
 
. : . : . : . : . : . :
JMSF024A06- TCTTTTTATAATCGGTTGTTTATTTCATCAACTTAAA
JMFN008P11- TCTT
rJMSF024A06+ TCTTTTTATAATCGGTTGTTTATTTCATCAACTTAAAGAGTAGTTGGCCTATTGGTGCTA
rJMSF024A07+ TCTTTTTATAATCGGTTGTTTATTTCATCAACTTAAAGAGTAGTTGGCCTATTGGTGCTA
rJMFF015E09+ TCTTTTTATAATCGGTTGTTTATTTCATCAACTTAAAGAGTAGTTGGCCTATTGGTGCTA
rJMFF030K24+ TCTTTTTATAATCGGTTGTTTATTTCATCAACTTAAAGAGTAGTTGGCCTATTGGTGCTA
                      ____________________________________________________________
consensus TCTTTTTATAATCGGTTGTTTATTTCATCAACTTAAAGAGTAGTTGGCCTATTGGTGCTA
 
. : . : . : . : . : . :
rJMSF024A06+ CAGAACCAGAACTGCTATGTTTTAGTGTTT
rJMSF024A07+ CAGAACCAGAACT
rJMFF015E09+ CAGAACCAGAACTGCTATGTTTTAGTGTTTTAAAATTCCAAACATACAATGCAGTTTTGG
rJMFF030K24+ CAGAACCAGAACTGCTATGTTTTAGTGTTTTAAAATTCCAAACATACAATGCAGTTTTGG
                      ____________________________________________________________
consensus CAGAACCAGAACTGCTATGTTTTAGTGTTTTAAAATTCCAAACATACAATGCAGTTTTGG
 
. : . : . : . : . : . :
rJMFF015E09+ TATTCTTGTTTATTTTTCTTATCAAATGTAGTTTTGATCAAAGT
rJMFF030K24+ TATTCTTGTTTATTTTTCTTATCAAATGTAGTTTTGATCAAAGTTGAAGATAATAAAGAT
                      ____________________________________________________________
consensus TATTCTTGTTTATTTTTCTTATCAAATGTAGTTTTGATCAAAGTTGAAGATAATAAAGAT