Previous Contig 009636:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030H07Sequence458014665736009636 (3)gb:OSJN00239_16972266e-55Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0039G19, complete seque
JMFF035H19Sequence597001569 (2)692009636 (3)gb:OSJN00239_16972267e-58Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0039G19, complete seque
JMSF031G05Sequence657019665gb:CQ785706_14527655e-25Sequence 19 from Patent WO2004018687.249009636 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF035H19+ CTAGTCAGG
                      ____________________________________________________________
consensus CTAGTCAGG
 
. : . : . : . : . : . :
rJMFF035H19+ TACNTCTTGAGGATAATGTGCCTAGTAAGATTACTCCACCTCCTCCAAAGAAGCAGCCAG
rJMFF030H07+ CCAAAGAAGCAGCCAG
                      ____________________________________________________________
consensus TACNTCTTGAGGATAATGTGCCTAGTAAGATTACTCCACCTCCTCCAAAGAAGCAGCCAG
 
. : . : . : . : . : . :
rJMFF035H19+ TCAATATGCTAGAGGGAAAAAGTAGGCTAGCTGAGTTTCGTAGTCCTACTCTATACAAGG
rJMFF030H07+ TCAATATGCTAGAGGGAAAAAGTAGGCTAGCCGAGTTTCGTAGTCCCACACTATACAAGG
                      ____________________________________________________________
consensus TCAATATGCTAGAGGGAAAAAGTAGGCTAGCTGAGTTTCGTAGTCCTACTCTATACAAGG
 
. : . : . : . : . : . :
rJMFF035H19+ ATGAAGAGAAGATGAGGGCTGCAATGAAAGAGCAGGCCTATGTGCCTGATACCAGATATG
rJMFF030H07+ ATGAAGAGAAGATGAGAGCTGCAATGAAAGAGCAGGCCTATGTGCCTGATACCAGATATG
                      ____________________________________________________________
consensus ATGAAGAGAAGATGAGGGCTGCAATGAAAGAGCAGGCCTATGTGCCTGATACCAGATATG
 
. : . : . : . : . : . :
rJMFF035H19+ TTCTTCATGATATTGATCAAGAGGCGAAGGAGCAGGCCTTGCTATATCATAGCGAGCGCT
rJMFF030H07+ TTCTTCATGATATTGATCAAGAGGCAAAGGAGCAGGCCTTGCTATATCATAGCGAGCGCT
                      ____________________________________________________________
consensus TTCTTCATGATATTGATCAAGAGGCGAAGGAGCAGGCCTTGCTATATCATAGCGAGCGCT
 
. : . : . : . : . : . :
rJMFF035H19+ TAGCCATTGCATATGGTCTCATTAGTACCCCAGCTAGAACACCTTTGCGTATAATCAAGA
rJMFF030H07+ TAGCCATTGCATATGGTCTCATTAGTACGCCAGCTAGAACACCTTTGCGTATAATCAAGA
                      ____________________________________________________________
consensus TAGCCATTGCATATGGTCTCATTAGTACGCCAGCTAGAACACCTTTGCGTATAATCAAGA
 
. : . : . : . : . : . :
rJMFF035H19+ ACTTACGTGTCTGTGGTGATTGCCATAATGCCATCAAGATCATGTCCAGAATTGTTGGGA
rJMFF030H07+ ACTTACGTGTCTGTGGTGATTGCCATAATGCCATCAAGATCATGTCCAGAATTGTTGGGA
                      ____________________________________________________________
consensus ACTTACGTGTCTGTGGTGATTGCCATAATGCCATCAAGATCATGTCCAGAATTGTTGGGA
 
. : . : . : . : . : . :
rJMFF035H19+ GAGAGTTGATTGTTAGGGATAACAAGCGTTTCCATCATTTCAAGGATGGAAAATGCTCTT
rJMFF030H07+ GAGAGTTGATTGTTAGGGATAACAAGCGTTTCCATCATTTCAAGGATGGAAAATGCTCTT
                      ____________________________________________________________
consensus GAGAGTTGATTGTTAGGGATAACAAGCGTTTCCATCATTTCAAGGATGGAAAATGCTCTT
 
. : . : . : . : . : . :
rJMFF035H19+ GTGGAGACTATTGGTAGTTACAACAACTGGAACTCGTGATTAGTAGA
rJMFF030H07+ GTGGAGACTATTGGTAGTTACAACAACTGGAACTCATGATTAGTAGACTGGTAGAAACAC
                      ____________________________________________________________
consensus GTGGAGACTATTGGTAGTTACAACAACTGGAACTCGTGATTAGTAGACTGGTAGAAACAC
 
. : . : . : . : . : . :
rJMSF031G05+ TGATACGTTCATTGGCAAAACATATCAGCGAA
rJMFF030H07+ CTTCAAGGCCTAACAGGAACCATTACTGTGATACGTTCATTGGCAAAACATATCAGCGAA
                      ____________________________________________________________
consensus CTTCAAGGCCTAACAGGAACCATTACTGTGATACGTTCATTGGCAAAACATATCAGCGAA
 
. : . : . : . : . : . :
rJMSF031G05+ GGAAGAAGAAGGTGGCAGCAGCCTAGGACTTTTTCAAAATAAATATTTCCTATCTTCTTG
rJMFF030H07+ GGAAGAAGAAGGTGGCAGCAGCCTAGGACTTTTTCAAAATAAATATTTCCTATCTTCTTG
                      ____________________________________________________________
consensus GGAAGAAGAAGGTGGCAGCAGCCTAGGACTTTTTCAAAATAAATATTTCCTATCTTCTTG
 
. : . : . : . : . : . :
rJMSF031G05+ TTTGTTAACGTTACTATTAGTTTGTTAACGTTATTATTAGTTTTGCTTCTCCTGCTTTCT
rJMFF030H07+ TTTGTTAACGTTACTATTAGTTTGTTAACGTTATTATTAGTTTTGCTTCTCCTGCTTTCT
                      ____________________________________________________________
consensus TTTGTTAACGTTACTATTAGTTTGTTAACGTTATTATTAGTTTTGCTTCTCCTGCTTTCT
 
. : . : . : . : . : . :
rJMSF031G05+ AGGATAGGTTCTTTATTTCTTGTATTTAAGTCTCGCCATGCATGGGGGGAGATCATCTTG
rJMFF030H07+ AGGATAGGTTCTTTATTTCTTGTATTTAAGTCTCGCCATGCATGGGGGGAGATCATCTTG
                      ____________________________________________________________
consensus AGGATAGGTTCTTTATTTCTTGTATTTAAGTCTCGCCATGCATGGGGGGAGATCATCTTG
 
. : . : . : . : . : . :
rJMSF031G05+ GATTTTA-TTTTTGGCTTTCAAGTATANGAAAGA
rJMFF030H07+ GATTTTATTTTTTGGCTTTCAAGTATATGAAAGATTGGGAGGAGAAGCACTCCAGAAACG
                      ____________________________________________________________
consensus GATTTTATTTTTTGGCTTTCAAGTATATGAAAGATTGGGAGGAGAAGCACTCCAGAAACG