Previous Contig 009634:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030G21Sequence519005047 (2)gb:AY052303_15626763e-45Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531 636009634 (3)gb:AP004225_18389489e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B115
JMSF009A03Sequence278005047 (2)760009634 (3)gb:AY052303_15626761e-79Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531
JMSF018I08Sequence245013055 (8)gb:AY052303_15626761e-38Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531 735009634 (3)gb:AY052303_15626765e-70Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009A03+ GA
                      ____________________________________________________________
consensus GA
 
. : . : . : . : . : . :
rJMSF009A03+ GAAAAATCGGAAACTGAATGACTTGCTTGATGCTCTGGACTTTAATCAAGTTGTTATCTT
rJMSF018I08+ AATCAAGTTGTTATCTT
                      ____________________________________________________________
consensus GAAAAATCGGAAACTGAATGACTTGCTTGATGCTCTGGACTTTAATCAAGTTGTTATCTT
 
. : . : . : . : . : . :
rJMSF009A03+ TGTCAAAAGTGTGAATAGGGCTGCTGAGCTAAACAAGTTACTTGTTGAATGTAATTTTCC
rJMSF018I08+ NGTCAAAAGTGTGAATAGGGCTGCTGAGCTAAACAAGTTACTTGTTGAATGTAATTTTCC
                      ____________________________________________________________
consensus TGTCAAAAGTGTGAATAGGGCTGCTGAGCTAAACAAGTTACTTGTTGAATGTAATTTTCC
 
. : . : . : . : . : . :
rJMSF009A03+ ATCAATCTGCATCCACTCTGGCATGTCTCAGGAAGAGAGACTGACACGTTACAAGGGTTT
rJMSF018I08+ ATCAATCTGCATCCACTCTGGCATGTCTCAGGAAGAGAGACTGACACGTTACAAGGGTTT
rJMFF030G21+ GAGAGACTGACACGTTACAAGGGTTT
                      ____________________________________________________________
consensus ATCAATCTGCATCCACTCTGGCATGTCTCAGGAAGAGAGACTGACACGTTACAAGGGTTT
 
. : . : . : . : . : . :
rJMSF009A03+ CAAGGAGGGGCACAAGAGAATTCTTGTTGCTACTGATTTGGTTGGCAGGGGCATTGATAT
rJMSF018I08+ CAAGGAGGGGCACAAGAGAATTCTTGTTGCTACTGATTTGGTTGGCAGGGGCATTGATAT
rJMFF030G21+ CAAGGAGGGGCACAAGAGAATTCTTGTTGCTACTGATTTGGTTGGCAGGGGCATTGATAT
                      ____________________________________________________________
consensus CAAGGAGGGGCACAAGAGAATTCTTGTTGCTACTGATTTGGTTGGCAGGGGCATTGATAT
 
. : . : . : . : . : . :
rJMSF009A03+ TGAACGGGTTAACATTGTCATTAACTATGACATGCCCGACTCTGCTGACACTTACCTTCA
rJMSF018I08+ TGAACGGGTTAACATTGTCATTAACTATGACATGCCCGACTCTGCTGACACTTACCTTCA
rJMFF030G21+ TGAACGGGTTAACATTGTCATTAACTATGACATGCCCGACTCTGCTGACACTTACCTTCA
                      ____________________________________________________________
consensus TGAACGGGTTAACATTGTCATTAACTATGACATGCCCGACTCTGCTGACACTTACCTTCA
 
. : . : . : . : . : . :
rJMSF009A03+ CAGGGTGGGTCGAGCTGGTCGGTTTGGCACTAAGGGTCTTGCTATAACTTTTGTTTCATC
rJMSF018I08+ CAGGGTGGGTCGAGCTGGTCGGTTTGGCACTAAGGGTCTTGCTATAACTTTTGTTTCATC
rJMFF030G21+ CAGGGTGGGTCGAGCTGGTCGGTTTGGCACTAAGGGTCTTGCTATAACTTTTGTTTCATC
                      ____________________________________________________________
consensus CAGGGTGGGTCGAGCTGGTCGGTTTGGCACTAAGGGTCTTGCTATAACTTTTGTTTCATC
 
. : . : . : . : . : . :
rJMSF009A03+ ATCATCAGATTCAGATGTACTGAATCAGGTTCAGGAAAGGTTCGAAGTTGATATCAAAGA
rJMSF018I08+ ATCATCAGATTCAGATGTACTGAATCAGGTTCAGGAAAGGTTCGAAGTTGATATCAAAGA
rJMFF030G21+ ATCATCAGATTCAGATGTACTGAATCAGGTTCAGGAAAGGTTCGAAGTTGATATCAAAGA
                      ____________________________________________________________
consensus ATCATCAGATTCAGATGTACTGAATCAGGTTCAGGAAAGGTTCGAAGTTGATATCAAAGA
 
. : . : . : . : . : . :
rJMSF009A03+ GCTACCTGAGCAGATCGATACTTCTACTTATATGCCATCGTAATGAAATGGGGCGCAGTT
rJMSF018I08+ GCTACCTGAGCAGATCGATACTTCTACTTATATGCCATCGTAATGAAATGGGGCGCAGTT
rJMFF030G21+ GCTACCTGAGCAGATCGATACTTCTACTTATATGCCATCGTAATGAAATGGGGCGCAGTT
                      ____________________________________________________________
consensus GCTACCTGAGCAGATCGATACTTCTACTTATATGCCATCGTAATGAAATGGGGCGCAGTT
 
. : . : . : . : . : . :
rJMSF009A03+ GCCTTCAAGAATTGTGAGTGATGAGCAAATAGTTTGCAAGGAGAGAAGTAATTCCTGGCT
rJMSF018I08+ GCCTTCAAGAATTGTGAGTGATGAGCAAATAGTTTGCAAGGAGAGAAGTAATTCCTGGCT
rJMFF030G21+ GCCTTCAAGAATTGTGAGTGATGAGCAAATAGTTTGCAAGGAGAGAAGTAATTCCTGGCT
                      ____________________________________________________________
consensus GCCTTCAAGAATTGTGAGTGATGAGCAAATAGTTTGCAAGGAGAGAAGTAATTCCTGGCT
 
. : . : . : . : . : . :
rJMSF009A03+ CGCGTGTTTTCATCTATATGCTATCGAATGTTTTGTACCATTTATGAAGACGTAGTGTTT
rJMSF018I08+ CGCGTGTTTTCATCTATATGCTATCGAATGTTTTGTACCATTTATGAAGACGTAGTGTTT
rJMFF030G21+ CGCGTGTTTTCATCTATATGCTATCGAATGTTTTGTACCATTTATGAAGACGTAGTGTTT
                      ____________________________________________________________
consensus CGCGTGTTTTCATCTATATGCTATCGAATGTTTTGTACCATTTATGAAGACGTAGTGTTT
 
. : . : . : . : . : . :
rJMSF009A03+ ACCTGCCTACCACATCATCGCATAGATCTAGGTTTATATTCCTGACTAGCTTTACCTGAC
rJMSF018I08+ ACCTGCCTACCACATCATCGCATAGATCTAGGTTTATATTCCTGACTAGCTTTACCTGAC
rJMFF030G21+ ACCTGCCTACCACATCATCGCATAGATCTAGGTTTATATTCCTGACTAGCTTTACCTGAC
                      ____________________________________________________________
consensus ACCTGCCTACCACATCATCGCATAGATCTAGGTTTATATTCCTGACTAGCTTTACCTGAC
 
. : . : . : . : . : . :
rJMSF009A03+ ATTATATTTATCAGTTTTCTAGATGTCAGCTAAATATTTTGGGTAATAGATTTTTTTGAG
rJMSF018I08+ ATTATATTTATCAGTTTTCTAGATGTCAGCTAAATATTTTGGGTAATAGATTTTTTTGAG
rJMFF030G21+ ATTATATTTATCAGTTTTCTAGATGTCAGCTAAATATTTTGGGTAATAGATTTTTTTGAG
                      ____________________________________________________________
consensus ATTATATTTATCAGTTTTCTAGATGTCAGCTAAATATTTTGGGTAATAGATTTTTTTGAG
 
. : . : . : . : . : . :
rJMSF009A03+ GTCAGTACCAAATAGATTGTTGGTGATGTAATATGTAT
rJMSF018I08+ GTCAGTACCAAATAGATTGTTGGTGATGTAATATGTATGGTTCAAAGTAGACGACCTA
rJMFF030G21+ GTCAGTACCAAATAGATTGTTGGTGATGTAATATGTATGGTTCAAAGTAGACGACCTAAC
                      ____________________________________________________________
consensus GTCAGTACCAAATAGATTGTTGGTGATGTAATATGTATGGTTCAAAGTAGACGACCTAAC