Previous Contig 009632:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030F24Sequence547009632 (2)gb:AY074858_15677094e-55Arabidopsis thaliana AT3g50440/T20E23_40 mRNA, complete cds.>gb:AY142031_1582868710009632 (2)gb:AY074858_15677097e-29Arabidopsis thaliana AT3g50440/T20E23_40 mRNA, complete cds.>gb:AY142031_1582868

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF030F24- AAAATAAAATAATGGAGGGAAATAATAAGAAGCATATT
                      ____________________________________________________________
consensus AAAATAAAATAATGGAGGGAAATAATAAGAAGCATATT
 
. : . : . : . : . : . :
JMFF030F24- GTTCTTGTCCATGGTATTTGCCATGGAGCTTGGTGCTGGTATAAGGTTGTAACGCTGCTC
                      ____________________________________________________________
consensus GTTCTTGTCCATGGTATTTGCCATGGAGCTTGGTGCTGGTATAAGGTTGTAACGCTGCTC
 
. : . : . : . : . : . :
JMFF030F24- AGACTTTCCGGCCACCGGGTGACGGCGTTGGACCTGGGCGCATGCGGTGTCCATCCGCGG
                      ____________________________________________________________
consensus AGACTTTCCGGCCACCGGGTGACGGCGTTGGACCTGGGCGCATGCGGTGTCCATCCGCGG
 
. : . : . : . : . : . :
JMFF030F24- CAGCTTAAGGAGATCGCCACGGCGGCAGATTACGTGCAGCCGTTGATGGAGTTGTTGGGC
                      ____________________________________________________________
consensus CAGCTTAAGGAGATCGCCACGGCGGCAGATTACGTGCAGCCGTTGATGGAGTTGTTGGGC
 
. : . : . : . : . : . :
JMFF030F24- AATCTTCCCCGGGATGAGAAGGTGGTTTTGGTTGGTCATAGTTATGGCGGGCTTCCTATT
                      ____________________________________________________________
consensus AATCTTCCCCGGGATGAGAAGGTGGTTTTGGTTGGTCATAGTTATGGCGGGCTTCCTATT
 
. : . : . : . : . : . :
JMFF030F24- TCTCTTGCCATGCAAAGTTTTCCGAACAAGATCTTGGTTGCCGTCTTCCTTGCTGCCTAC
                      ____________________________________________________________
consensus TCTCTTGCCATGCAAAGTTTTCCGAACAAGATCTTGGTTGCCGTCTTCCTTGCTGCCTAC
 
. : . : . : . : . : . :
JMFF030F24- ATGCCCAATCACTACACCCCTCCCGCCACTCTCATTCAAGAGTATTTCAGAAGGACTAGA
                      ____________________________________________________________
consensus ATGCCCAATCACTACACCCCTCCCGCCACTCTCATTCAAGAGTATTTCAGAAGGACTAGA
 
. : . : . : . : . : . :
JMFF030F24- ATGGAAACTCTAATGGATTGTCAATTAACATTTGACAAAGGACTGCAAAATCCACCAACT
rJMFF030F24+ TAATGGATNGTCAATTAACATTGGACAAAGGACTGCAAAATCCACCAACT
                      ____________________________________________________________
consensus ATGGAAACTCTAATGGATTGTCAATTAACATTTGACAAAGGACTGCAAAATCCACCAACT
 
. : . : . : . : . : . :
JMFF030F24- TCTGTTATTTTCGGTTCCAATTTCATGGAAGCCATGGTTTACACGCACTGCAAACCAGAG
rJMFF030F24+ TCTGTTATTTTCGGTTCCAATTTCATGGAAGCCATGGTTTACACGCACTGCAAACCAGAG
                      ____________________________________________________________
consensus TCTGTTATTTTCGGTTCCAATTTCATGGAAGCCATGGTTTACACGCACTGCAAACCAGAG
 
. : . : . : . : . : . :
JMFF030F24- GACTTGGAGCTAGGAAGAATGTTAATCAG
rJMFF030F24+ GACTTGGAGCTAGGAAGAATGTTAATCAGGCCAGGAGCTCTTTTTGTGGAGGAAATGGCA
                      ____________________________________________________________
consensus GACTTGGAGCTAGGAAGAATGTTAATCAGGCCAGGAGCTCTTTTTGTGGAGGAAATGGCA
 
. : . : . : . : . : . :
rJMFF030F24+ AAGGAAAATTTGCTGACAAAAGACAAATATGGTTCAGTGAAAAGAGTTTATATTATCTGC
                      ____________________________________________________________
consensus AAGGAAAATTTGCTGACAAAAGACAAATATGGTTCAGTGAAAAGAGTTTATATTATCTGC
 
. : . : . : . : . : . :
rJMFF030F24+ GAAGATGACCAAATTATGGACCAAGAATTTCAGATACATAACATACAAAATAGCCCTCCT
                      ____________________________________________________________
consensus GAAGATGACCAAATTATGGACCAAGAATTTCAGATACATAACATACAAAATAGCCCTCCT
 
. : . : . : . : . : . :
rJMFF030F24+ TGTGAAGTGAAATCCATGGCTGCAACTGGACATATGGCCATGCTATCAAAACCTGAGGAG
                      ____________________________________________________________
consensus TGTGAAGTGAAATCCATGGCTGCAACTGGACATATGGCCATGCTATCAAAACCTGAGGAG
 
. : . : . : . : . : . :
rJMFF030F24+ CTCTGCTTTAGCCTGCAGGAAATTATTGATGATGCTAACATGAAATGAAACTGATATTGC
                      ____________________________________________________________
consensus CTCTGCTTTAGCCTGCAGGAAATTATTGATGATGCTAACATGAAATGAAACTGATATTGC
 
. : . : . : . : . : . :
rJMFF030F24+ CACTGTTTGAGTTTTCAAGAAATTGTTGTCGTCATCATTAGAATGAAAAGCAGAGAAGGT
                      ____________________________________________________________
consensus CACTGTTTGAGTTTTCAAGAAATTGTTGTCGTCATCATTAGAATGAAAAGCAGAGAAGGT
 
. : . : . : . : . : . :
rJMFF030F24+ GGCCATTAACTCTGTTAAAACCACCTCTCCATGAGGACAAAATAGAATTATATAGCAACT
                      ____________________________________________________________
consensus GGCCATTAACTCTGTTAAAACCACCTCTCCATGAGGACAAAATAGAATTATATAGCAACT
 
. : . : . : . : . : . :
rJMFF030F24+ CTGAACCAAGTTGGTTAAGCTTAGTTTGGTAACCAGTTCAAATCTGTGGGAACAACTTAA
                      ____________________________________________________________
consensus CTGAACCAAGTTGGTTAAGCTTAGTTTGGTAACCAGTTCAAATCTGTGGGAACAACTTAA
 
. : . : . : . : . : . :
rJMFF030F24+ ACTAATTGTTTTTAGTCTTTTGTCAACTAAAATCACAAAGACTAATAGTATGTTTGATTG
                      ____________________________________________________________
consensus ACTAATTGTTTTTAGTCTTTTGTCAACTAAAATCACAAAGACTAATAGTATGTTTGATTG
 
. : . : . : . : . : . :
rJMFF030F24+ TACTAAAAAAAACAGTATGTTTGATTCTCAAATCAAATAAGATAAGAATGAAATATCATA
                      ____________________________________________________________
consensus TACTAAAAAAAACAGTATGTTTGATTCTCAAATCAAATAAGATAAGAATGAAATATCATA