Previous Contig 009630:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001L11Sequence522009630 (11)gb:AF412059_17973122e-55Arabidopsis thaliana F5I14.29/F5I14.29 mRNA, complete cds.743009630 (11)gb:AF412059_17973123e-46Arabidopsis thaliana F5I14.29/F5I14.29 mRNA, complete cds.
JMFF030F10Sequence527009630 (11)gb:AF412059_17973128e-56Arabidopsis thaliana F5I14.29/F5I14.29 mRNA, complete cds.708009630 (11)gb:AF412059_17973125e-45Arabidopsis thaliana F5I14.29/F5I14.29 mRNA, complete cds.
JMFN031H01Sequence625009630 (11)gb:AF412059_17973129e-55Arabidopsis thaliana F5I14.29/F5I14.29 mRNA, complete cds.
JMSF003E14Sequence411009630 (11)gb:AP004020_18364832e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11740009630 (11)gb:AY065083_15662378e-84Arabidopsis thaliana unknown protein (At1g65650; F5I14.18) mRNA, complete cds.>g
JMSF010C16Sequence244009630 (11)763009630 (11)gb:AY065083_15662372e-87Arabidopsis thaliana unknown protein (At1g65650; F5I14.18) mRNA, complete cds.>g
JMSF025D15Sequence699009630 (11)gb:AY065083_15662378e-91Arabidopsis thaliana unknown protein (At1g65650; F5I14.18) mRNA, complete cds.>g756009630 (11)gb:AY065083_1566237e-102Arabidopsis thaliana unknown protein (At1g65650; F5I14.18) mRNA, complete cds.>g

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF010C16- GGTTAGAAGCTGCAACCCTAGGCCCTTGCC
                      ____________________________________________________________
consensus GGTTAGAAGCTGCAACCCTAGGCCCTTGCC
 
. : . : . : . : . : . :
JMSF010C16- CAAAAATCAATACAGTCAAAACTCCATTAAAACTCTACTGTTCGGAGGTTGAAATACCGA
JMSF003E14- GA
JMFF001L11- GGTTGAAATACCGA
JMFF030F10- GGTTGAAATACCGA
JMSF025D15- GA
                      ____________________________________________________________
consensus CAAAAATCAATACAGTCAAAACTCCATTAAAACTCTACTGTTCGGAGGTTGAAATACCGA
 
. : . : . : . : . : . :
JMSF010C16- CAATAACCACTACTCCACCGTGAAATCCAGATATATCTCTCAAGTCTCCGTACCGGCCGC
JMSF003E14- CAATAACCACTACTCCACCGTGAAATCCAGATATATCTCTCAAGTCTCCGTACCGGCCGC
JMFF001L11- CAATAACCACTACTCCACCGTGAAATCCAGATATATCTCTCAAGTCTCCGTACCGGCCGC
JMFF030F10- CAATAACCACTACTCCACCGTGAAATCCAGATATATCTCTCAAGTCTCCGTACCGGCCGC
JMSF025D15- CAATAACCACTACTCCACCGTGAAATCCAGATATATCTCTCAAGTCTCCGTACCGGCCGC
                      ____________________________________________________________
consensus CAATAACCACTACTCCACCGTGAAATCCAGATATATCTCTCAAGTCTCCGTACCGGCCGC
 
. : . : . : . : . : . :
JMSF010C16- CGCGTCCCACCTTCTGACGGCCGTCCTCCTTCTCCGCTGCTTATCTTCTGCTTACGTAAA
JMSF003E14- CGCGTCCCACCTTCTGACGGCCGTCCTCCTTCTCCGCTGCTTATCTTCTGCTTACGTAAA
JMFF001L11- CGCGTCCCACCTTCTGACGGCCGTCCTCCTTCTCCGCTGCTTATCTTCTGCTTACGTAAA
JMFF030F10- CGCGTCCCACCTTCTGACGGCCGTCCTCCTTCTCCGCTGCTTATCTTCTGCTTACGTAAA
JMSF025D15- CGCGTCCCACCTTCTGACGGCCGTCCTCCTTCTCCGCTGCTTATCTTCTGCTTACGTAAA
                      ____________________________________________________________
consensus CGCGTCCCACCTTCTGACGGCCGTCCTCCTTCTCCGCTGCTTATCTTCTGCTTACGTAAA
 
. : . : . : . : . : . :
JMSF010C16- GATCATTCATCATGTCTTGGTGCACTATCGAATC
JMSF003E14- GATCATTCATCATGTCTTGGTGCACTATCGAATCAGATCCCGGGGTTTTCACTGAGCTTA
JMFF001L11- GATCATTCATCATGTCTTGGTGCACTATCGAATCAGATCCCGGGGTTTTCACTGAGCTTA
JMFF030F10- GATCATTCATCATGTCTTGGTGCACTATCGAATCAGATCCCGGGGTTTTCACTGAGCTTA
JMSF025D15- GATCATTCATCATGTCTTGGTGCACTATCGAATCAGATCCCGGGGTTTTCACTGAGCTTA
                      ____________________________________________________________
consensus GATCATTCATCATGTCTTGGTGCACTATCGAATCAGATCCCGGGGTTTTCACTGAGCTTA
 
. : . : . : . : . : . :
JMSF003E14- TTCAGCAAATGCAAGTAAAGGGAGTGCAGGTTGAGGAATTGTATTCACTGGATATCGACG
JMFF001L11- TTCAGCAAATGCAAGTAAAGGGAGTGCAGGTTGAGGAATTGTATTCACTGGATATCGACG
JMFF030F10- TTCAGCAAATGCAAGTAAAGGGAGTGCAGGTTGAGGAATTGTATTCACTGGATATCGACG
JMSF025D15- TTCAGCAAATGCAAGTAAAGGGAGTGCAGGTTGAGGAATTGTATTCACTGGATATCGACG
                      ____________________________________________________________
consensus TTCAGCAAATGCAAGTAAAGGGAGTGCAGGTTGAGGAATTGTATTCACTGGATATCGACG
 
. : . : . : . : . : . :
JMSF003E14- CCCTCAACAACCTTAGGCCAATCTATGGATTAATATTTCTTTTCAAGTGGCGACCGGATG
JMFF001L11- CCCTCAACAACCTTAGGCCAATCTATGGATTAATATTTCTTTTCAAGTGGCGACCGGATG
JMFF030F10- CCCTCAACAACCTTAGGCCAATCTATGGATTAATATTTCTTTTCAAGTGGCGACCGGATG
JMSF025D15- CCCTCAACAACCTTAGGCCAATCTATGGATTAATATTTCTTTTCAAGTGGCGACCGGATG
                      ____________________________________________________________
consensus CCCTCAACAACCTTAGGCCAATCTATGGATTAATATTTCTTTTCAAGTGGCGACCGGATG
 
. : . : . : . : . : . :
JMSF003E14- AAAAAGATGACCGTCTTGTGATTAAGGATCCCAGTCCTAACTTGTTCTTTGCTAGCCAGG
JMFF001L11- AAAAAGATGACCGTCTTGTGATTAAGGATCCCAGTCCTAACTTGTTCTTTGCTAGCCAGG
JMFF030F10- AAAAAGATGACCGTCTTGTGATTAAGGATCCCAGTCCTAACTTGTTCTTTGCTAGCCAGG
JMSF025D15- AAAAAGATGACCGTCTTGTGATTAAGGATCCCAGTCCTAACTTGTTCTTTGCTAGCCAGG
                      ____________________________________________________________
consensus AAAAAGATGACCGTCTTGTGATTAAGGATCCCAGTCCTAACTTGTTCTTTGCTAGCCAGG
 
. : . : . : . : . : . :
JMSF003E14- TTATCAATAATGCGTGTGCTACCCAAGCAATCCTGTCCATTCTTCTGA
JMFF001L11- TTATCAATAATGCGTGTGCTACCCAAGCAATCCTGTCCATTCTTCTGAACAGCCCAGATA
JMFF030F10- TTATCAATAATGCGTGTGCTACCCAAGCAATCCTGTCCATTCTTCTGAACAGCCCAGATA
JMSF025D15- TTATCAATAATGCGTGTGCTACCCAAGCAATCCTGTCCATTCTTCTGAACAGCCCAGATA
rJMSF025D15+ TGAACAGCCCAGATA
                      ____________________________________________________________
consensus TTATCAATAATGCGTGTGCTACCCAAGCAATCCTGTCCATTCTTCTGAACAGCCCAGATA
 
. : . : . : . : . : . :
JMFF001L11- TTGACATTGGCCCAGAACTATCACAGTTGAAAGAATTCACAAAGAACTTTCCACCCGAGC
JMFF030F10- TTGACATTGGCCCAGAACTATCACAGTTGAAAGAATTCACAAAGAACTTTCCACCCGAGC
JMSF025D15- TTGACATTGGCCCAGAACTATCACAGTTGAAAGAATTCACAAAGAACTTTCCACCCGAGC
rJMSF025D15+ TTGACATTGGCCCAGAACTATCACAGTTGAAAGAATTCACAAAGAACTTTCCACCCGAGC
                      ____________________________________________________________
consensus TTGACATTGGCCCAGAACTATCACAGTTGAAAGAATTCACAAAGAACTTTCCACCCGAGC
 
. : . : . : . : . : . :
JMFF001L11- TTAAAGGTTTAGCTATCAATAACAGTGA
JMFF030F10- TTAAAGGTTTAGCTATCAATAACAGTGA
JMSF025D15- TTAAAGGTTTAGCTATCAATAACAGTGAGGCAATTCGAGGTGCCCATAATAGCTTTGCAA
rJMSF025D15+ TTAAAGGTTTAGCTATCAATAACAGTGAGGCAATTCGAGGTGCCCATAATAGCTTTGCAA
rJMSF010C16+ CTATCAATAACAGTGAGGCAATTCGAGGTGCCCATAATAGCTTTGCAA
rJMSF003E14+ GAGGTGCCCATAATAGCTTTGCAA
                      ____________________________________________________________
consensus TTAAAGGTTTAGCTATCAATAACAGTGAGGCAATTCGAGGTGCCCATAATAGCTTTGCAA
 
. : . : . : . : . : . :
JMSF025D15- GACCAGAGCCCTTTGTTCCCGAGGAGCAGAAATCTGCTGGGAAAGATGATGATGTTTACC
rJMSF025D15+ GACCAGAGCCCTTTGTTCCCGAGGAGCAGAAATCTGCTGGGAAAGATGATGATGTTTACC
rJMSF010C16+ GACCAGAGCCCTTTGTTCCCGAGGAGCAGAAATCTGCTGGGAAAGATGATGATGTTTACC
rJMSF003E14+ GACCAGAGCCCTTTGTTCCCGAGGAGCAGAAATCTGCTGGGAAAGATGATGATGTTTACC
                      ____________________________________________________________
consensus GACCAGAGCCCTTTGTTCCCGAGGAGCAGAAATCTGCTGGGAAAGATGATGATGTTTACC
 
. : . : . : . : . : . :
JMSF025D15- ATTTCATAAGCTACATACCAGTCGATGGTATACTCTATGAGCTTGATGGATTGAAAGAAG
rJMSF025D15+ ATTTCATAAGCTACATACCAGTCGATGGTATACTCTATGAGCTTGATGGATTGAAAGAAG
rJMSF010C16+ ATTTCATAAGCTACATACCAGTCGATGGTATACTCTATGAGCTTGATGGATTGAAAGAAG
rJMSF003E14+ ATTTCATAAGCTACATACCAGTCGATGGTATACTCTATGAGCTTGATGGATTGAAAGAAG
                      ____________________________________________________________
consensus ATTTCATAAGCTACATACCAGTCGATGGTATACTCTATGAGCTTGATGGATTGAAAGAAG
 
. : . : . : . : . : . :
JMSF025D15- GTCCCATCAGCCTCGGTCCATGCCCT-GGTGGGCACA
rJMSF025D15+ GTCCCATCAGCCTCGGTCCATGCCCT-GGTGGGCACAATGACCTAGATTGGTTGCGTTTG
rJMSF010C16+ GTCCCATCAGCCTCGGTCCATGCCCT-GGTGGGCACAATGACCTAGATTGGTTGCGTTTG
rJMSF003E14+ GTCCCATCAGCCTCGGTCCATGCCCT-GGTGGGCACAATGACCTAGATTGGTTGCGTTTG
JMFN031H01+ AGCCTCGGTCCATGCCCT-GGTGGGCACAATGACCTAGATTGGTTGCGTTTG
rJMFF001L11+ GTCCATGCCCTGGGTGGCCACAATGACCTAGATTGGTTGCGTTTG
                      ____________________________________________________________
consensus GTCCCATCAGCCTCGGTCCATGCCCT-GGTGGGCACAATGACCTAGATTGGTTGCGTTTG
 
. : . : . : . : . : . :
rJMSF025D15+ GTGCAG-CCAGTGATTCAGGAACGCATTGAAAAGTACTCGAGAAATGAAATTAGGTTCAA
rJMSF010C16+ GTGCAG-CCAGTGATTCAGGAACGCATTGAAAAGTACTCGAGAAATGAAATTAGGTTCAA
rJMSF003E14+ GTGCAG-CCAGTGATTCAGGAACGCATTGAAAAGTACTCGAGAAATGAAATTAGGTTCAA
JMFN031H01+ GTGCAG-CCAGTGATTCAGGAACGCATTGAAAAGTACTCGAGAAATGAAATTAGGTTCAA
rJMFF001L11+ GTGCAGCCCAGTGATTCAGGAACGCATTGAAAAGTACTCGAGAAATGAAATTAGGTTCAA
rJMFF030F10+ TGATTCAGGAACGCATTGAAAAGTACTCGAGAAATGAAATTAGGTTCAA
                      ____________________________________________________________
consensus GTGCAG-CCAGTGATTCAGGAACGCATTGAAAAGTACTCGAGAAATGAAATTAGGTTCAA
 
. : . : . : . : . : . :
rJMSF025D15+ CCTGATGGCCGTAATAAAGAACAGGAAAGACATGTATACAGCCGAGCTAAAGGAGCTTCA
rJMSF010C16+ CCTGATGGCCGTAATAAAGAACAGGAAAGACATGTATACAGCCGAGCTAAAGGAGCTTCA
rJMSF003E14+ CCTGATGGCCGTAATAAAGAACAGGAAAGACATGTATACAGCCGAGCTAAAGGAGCTTCA
JMFN031H01+ CCTGATGGCCGTAATAAAGAACAGGAAAGACATGTATACAGCCGAGCTAAAGGAGCTTCA
rJMFF001L11+ CCTGATGGCCGTAATAAAGAACAGGAAAGACATGTATACAGCCGAGCTAAAGGAGCTTCA
rJMFF030F10+ CCTGATGGCCGTAATAAAGAACAGGAAAGACATGTATACAGCCGAGCTAAAGGAGCTTCA
                      ____________________________________________________________
consensus CCTGATGGCCGTAATAAAGAACAGGAAAGACATGTATACAGCCGAGCTAAAGGAGCTTCA
 
. : . : . : . : . : . :
rJMSF025D15+ AAGAAAAAGGGAACGCATCCTGCAGCAACTGGCTACTTTACAGTCGGAGAGGCTGGTCGA
rJMSF010C16+ AAGAAAAAGGGAACGCATCCTGCAGCAACTGGCTACTTTACAGTCGGAGAGGCTGGTCGA
rJMSF003E14+ AAGAAAAAGGGAACGCATCCTGCAGCAACTGGCTACTTTACAGTCGGAGAGGCTGGTCGA
JMFN031H01+ AAGAAAAAGGGAACGCATCCTGCAGCAACTGGCTACTTTACAGTCGGAGAGGCTGGTCGA
rJMFF001L11+ AAGAAAAAGGGAACGCATCCTGCAGCAACTGGCTACTTTACAGTCGGAGAGGCTGGTCGA
rJMFF030F10+ AAGAAAAAGGGAACGCATCCTGCAGCAACTGGCTACTTTACAGTCGGAGAGGCTGGTCGA
                      ____________________________________________________________
consensus AAGAAAAAGGGAACGCATCCTGCAGCAACTGGCTACTTTACAGTCGGAGAGGCTGGTCGA
 
. : . : . : . : . : . :
rJMSF025D15+ TAGCAGCAATGTGGAAGCTCTGAATAAATCACTAATGGAAGTGAATTCTGGCATTGAAGC
rJMSF010C16+ TAGCAGCAATGTGGAAGCTCTGAATAAATCACTAATGGAAGTGAATTCTGGCATTGAAGC
rJMSF003E14+ TAGCAGCAATGTGGAAGCTCTGAATAAATCACTAATGGAAGTGAATTCTGGCATTGAAGC
JMFN031H01+ TAGCAGCAATGTGGAAGCTCTGAATAAATCACTAATGGAAGTGAATTCTGGCATTGAAGC
rJMFF001L11+ TAGCAGCAATGTGGAAGCTCTGAATAAATCACTAATGGAAGTGAATTCTGGCATTGAAGC
rJMFF030F10+ TAGCAGCAATGTGGAAGCTCTGAATAAATCACTAATGGAAGTGAATTCTGGCATTGAAGC
                      ____________________________________________________________
consensus TAGCAGCAATGTGGAAGCTCTGAATAAATCACTAATGGAAGTGAATTCTGGCATTGAAGC
 
. : . : . : . : . : . :
rJMSF025D15+ GGCCACCGAGAAGATATTGATGGAGGAAGAGAAATTCAAGAAATGGAAAACAGAAAACAT
rJMSF010C16+ GGCCACCGAGAAGATATTGATGGAGGAAGAGAAGTTCAAGAAATGGAAAACAGAAAACAT
rJMSF003E14+ GGCCACCGAGAAGATATTGATGGAGGAAGAGAAGTTCAAGAAATGGAAAACAGAAAACAT
JMFN031H01+ GGCCACCGAGAAGATATTGATGGAGGAAGAGAAGTTCAAGAAATGGAAAACAGAAAACAT
rJMFF001L11+ GGCCACCGAGAAGATATTGATGGAGGAAGAGAAGTTCAAGAAATGGAAAACAGAAAACAT
rJMFF030F10+ GGCCACCGAGAAGATATTGATGGAGGAAGAGAAGTTCAAGAAATGGAAAACAGAAAACAT
                      ____________________________________________________________
consensus GGCCACCGAGAAGATATTGATGGAGGAAGAGAAGTTCAAGAAATGGAAAACAGAAAACAT
 
. : . : . : . : . : . :
rJMSF025D15+ TCGCCGAAAGCACAACTACATTCCCTTCCTGTTCAACTTCCTCAAGATTCTTGCTGAAAA
rJMSF010C16+ TCGCCGAAAGCACAACTACATTCCCTTCCTGTTCAACTTCCTCAAGATTCTTGCTGAAAA
rJMSF003E14+ TCGCCGAAAGCACAACTACATTCCCTTCCTGTTCAACTTCCTCAAGATTCTTGCTGAAAA
JMFN031H01+ TCGCCGAAAGCACAACTACATTCCCTTCCTGTTCAACTTCCTCAAGATTCTTGCTGAAAA
rJMFF001L11+ TCGCCGAAAGCACAACTACATTCCCTTCCTGTTCAACTTCCTCAAGATTCTTGCTGAAAA
rJMFF030F10+ TCGCCGAAAGCACAACTACATTCCCTTCCTGTTCAACTTCCTCAAGATTCTTGCTGAAAA
                      ____________________________________________________________
consensus TCGCCGAAAGCACAACTACATTCCCTTCCTGTTCAACTTCCTCAAGATTCTTGCTGAAAA
 
. : . : . : . : . : . :
rJMSF025D15+ GAAGCAGTTGAGACCTCTCATAGAGAAGGCCAAACAAAAAGCTAGCAAATCCTAGGTGAA
rJMSF010C16+ GAAGCAGTTGAGACCTCTCATAGAGAAGGCCAAACAAAAAGCTAGCAAATCCTAGGTGAA
rJMSF003E14+ GAAGCAGTTGAGACCTCTCATAGAGAAGGCCAAACAAAAAGCTAGCAAATCCTAGGTGAA
JMFN031H01+ GAAGCAGTTGAGACCTCTCATAGAGAAGGCCAAACAAAAAGCTAGCAAATCCTAGGTGAA
rJMFF001L11+ GAAGCAGTTGAGACCTCTCATAGAGAAGGCCAAACAAAAAGCTAGCAAATCCTAGGTGAA
rJMFF030F10+ GAAGCAGTTGAGACCTCTCATAGAGAAGGCCAAACAAAAAGCTAGCAAATCCTAGGTGAA
                      ____________________________________________________________
consensus GAAGCAGTTGAGACCTCTCATAGAGAAGGCCAAACAAAAAGCTAGCAAATCCTAGGTGAA
 
. : . : . : . : . : . :
rJMSF025D15+ AAGACCAAATGTACAACAACTTT
rJMSF010C16+ AAGA-CAAATGTACAACAACTTTATTAGACAACAATCTTGGTTGCTGAATTGTATTATGT
rJMSF003E14+ AAGA-CAAATGTACAACAACTTTATTAGACAACAATCTTGGTTGCTGAATTGTATTATGT
JMFN031H01+ AAGA-CAAATGTACAACAACTTTATTAGACAACAATCTTGGTTGCTGAATTGTATTATGT
rJMFF001L11+ AAGA-CAAATGTACAACAACTTTATTAGACAACAATCTTGGTTGCTGAATTGTATTATGT
rJMFF030F10+ AAGA-CAAATGTACAACAACTTTATTAGACAACAATCTTGGTTGCTGAATTGTATTATGT
                      ____________________________________________________________
consensus AAGA-CAAATGTACAACAACTTTATTAGACAACAATCTTGGTTGCTGAATTGTATTATGT
 
. : . : . : . : . : . :
rJMSF010C16+ ACTGTTATTTAACCACCCCAAGGTTTGCTTAGCACCCATGATTTTCTTATATTGCGTA
rJMSF003E14+ ACTGTTATTTAACCACCCCAAGGTTTGCTTAGCACCCATGATTTTCTTATATTGCGTAT
JMFN031H01+ ACTGTTATTTAACCACCCCAAGGTTTGCTTAGCACCCATGATTTTCTTATATTGCGTATT
rJMFF001L11+ ACTGTTATTTAACCACCCCAAGGTTTGCTTAGCACCCATGATTTTCTTATATTGCGTATT
rJMFF030F10+ ACTGTTATTTAACCACCCCAAGGTTTGCTTAGCACCCATGATTTTCTTATATTGCGTATT
                      ____________________________________________________________
consensus ACTGTTATTTAACCACCCCAAGGTTTGCTTAGCACCCATGATTTTCTTATATTGCGTATT
 
. : . : . : . : . : . :
JMFN031H01+ TTAGT
rJMFF001L11+ TTAGTAACTATTACCTTAAAATGAAATTCTGCATCTTCATCAAGTGGTTTGATTTGCTGC
rJMFF030F10+ TTAGTAACTATTACCTTAAAATGAAATTCTGCATCTTCATCAAGTGGTTTGATTTGCTGC
                      ____________________________________________________________
consensus TTAGTAACTATTACCTTAAAATGAAATTCTGCATCTTCATCAAGTGGTTTGATTTGCTGC
 
. : . : . : . : . : . :
rJMFF001L11+ TGCAGCAGTGTCTTCTCGTTTCACGCTTTTAATGATTTTGATTTGCACTCATGCTTCATT
rJMFF030F10+ TGCAGCAGTGTCTTCTCGTTTCACGCTTTTAATGATTTTGATTTGCACTCATGCTTCATT
                      ____________________________________________________________
consensus TGCAGCAGTGTCTTCTCGTTTCACGCTTTTAATGATTTTGATTTGCACTCATGCTTCATT
 
. : . : . : . : . : . :
rJMFF001L11+ CCTCTACTGTCGAGGAGATGAACAAAAGCCTGTATAAT
rJMFF030F10+ CCTCTACTGTCGAGGAGATGAACAAAAGCCTGTATAATACTCTCTATGTCCTACTTTACT
                      ____________________________________________________________
consensus CCTCTACTGTCGAGGAGATGAACAAAAGCCTGTATAATACTCTCTATGTCCTACTTTACT