Previous Contig 009627:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030D07Sequence459009627 (2)gb:NTA344154_16913478e-75Nicotiana tabacum mRNA for calcium-dependent protein kinase 2 (cdpk2 gene).742009627 (2)gb:NTA344154_16913477e-72Nicotiana tabacum mRNA for calcium-dependent protein kinase 2 (cdpk2 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF030D07- AAATGAAGCAATTCTCTGCGATGAATAAGCTCAA
                      ____________________________________________________________
consensus AAATGAAGCAATTCTCTGCGATGAATAAGCTCAA
 
. : . : . : . : . : . :
JMFF030D07- GAAAATGGCTTTAAGAGTCATTGCAGAGAACCTATCCGAAGAAGAAATTGCTGGGTTGAA
rJMFF030D07+ AAGAAGAAATTGCTGGGTTGAA
                      ____________________________________________________________
consensus GAAAATGGCTTTAAGAGTCATTGCAGAGAACCTATCCGAAGAAGAAATTGCTGGGTTGAA
 
. : . : . : . : . : . :
JMFF030D07- AGAAATGTTCAAGATGATAGATGCAGACAACAGCGGGCAAATCACTTTCGAGGAGCTCAA
rJMFF030D07+ AGAAATGTTCAAGATGATAGATGCAGACAACAGCGGGCAAATCACTTTCGAGGAGCTCAA
                      ____________________________________________________________
consensus AGAAATGTTCAAGATGATAGATGCAGACAACAGCGGGCAAATCACTTTCGAGGAGCTCAA
 
. : . : . : . : . : . :
JMFF030D07- AGCTGGATTGAAAAGAGTTGGTGCCAATCTCAAGGAGTCCGAGATCTATGACCTAATGCA
rJMFF030D07+ AGCTGGATTGAAAAGAGTTGGTGCCAATCTCAAGGAGTCCGAGATCTATGACCTAATGCA
                      ____________________________________________________________
consensus AGCTGGATTGAAAAGAGTTGGTGCCAATCTCAAGGAGTCCGAGATCTATGACCTAATGCA
 
. : . : . : . : . : . :
JMFF030D07- AGCTGCTGATGTTGATAACAGTGGAACAATCGATTATGGCGAGTTTATAGCTGCAACGTT
rJMFF030D07+ AGCTGCTGATGTTGATAACAGTGGAACAATCGATTATGGCGAGTTTATAGCTGCAACGTT
                      ____________________________________________________________
consensus AGCTGCTGATGTTGATAACAGTGGAACAATCGATTATGGCGAGTTTATAGCTGCAACGTT
 
. : . : . : . : . : . :
JMFF030D07- ACATTTTAACAAAATTGAGAGAGAGGATCATCTGTTTGCCGCTTTCTCCTATTTTGACAA
rJMFF030D07+ ACATTTTAACAAAATTGAGAGAGAGGATCATCTGTTTGCCGCTTTCTCCTATTTTGACAA
                      ____________________________________________________________
consensus ACATTTTAACAAAATTGAGAGAGAGGATCATCTGTTTGCCGCTTTCTCCTATTTTGACAA
 
. : . : . : . : . : . :
JMFF030D07- GGATGGAAGTGGCTTTATCACTGCAGACGAACTGCAACAAGCCTGCGAGGAATTTGGGAT
rJMFF030D07+ GGATGGAAGTGGCTTTATCACTGCAGACGAACTGCAACAAGCCTGCGAGGAATTTGGGAT
                      ____________________________________________________________
consensus GGATGGAAGTGGCTTTATCACTGCAGACGAACTGCAACAAGCCTGCGAGGAATTTGGGAT
 
. : . : . : . : . : . :
JMFF030D07- TGAAGATGCCCGCCTGGAAGAAATGATTCGGGAAGCTGACCAAAATAACGATGGAACCAT
rJMFF030D07+ TGAAGATGCCCGCCTGGAAGAAATGATTCGGGAAGCTGACCAAAATAACGATGGAACCAT
                      ____________________________________________________________
consensus TGAAGATGCCCGCCTGGAAGAAATGATTCGGGAAGCTGACCAAAATAACGATGGAACCAT
 
. : . : . : . : . : . :
JMFF030D07- TGATT
rJMFF030D07+ TGATTACAATGAATTCGTGGCGATGATGCAAAAAGGAAATCCAGTATTGGGGGTCTCTCG
                      ____________________________________________________________
consensus TGATTACAATGAATTCGTGGCGATGATGCAAAAAGGAAATCCAGTATTGGGGGTCTCTCG
 
. : . : . : . : . : . :
rJMFF030D07+ AAAGGCCAAGAAAATAGTAGTTTCAGCATTCGATTTAGGGAGGCCCTAAGAACCTAGACT
                      ____________________________________________________________
consensus AAAGGCCAAGAAAATAGTAGTTTCAGCATTCGATTTAGGGAGGCCCTAAGAACCTAGACT
 
. : . : . : . : . : . :
rJMFF030D07+ TCCCTTATTTGTTCTTCACTGTTTTTTTTGTTCTTTTTGTATGACAAATTTGTTGTGATA
                      ____________________________________________________________
consensus TCCCTTATTTGTTCTTCACTGTTTTTTTTGTTCTTTTTGTATGACAAATTTGTTGTGATA
 
. : . : . : . : . : . :
rJMFF030D07+ GGGTCCTTTTTATAGTGATTTGGAGAAAACAGCCATCTTTTATTGCACTTTTATAGTTTT
                      ____________________________________________________________
consensus GGGTCCTTTTTATAGTGATTTGGAGAAAACAGCCATCTTTTATTGCACTTTTATAGTTTT
 
. : . : . : . : . : . :
rJMFF030D07+ CACAATCTCTTTTCCCTGTCTGCATCTGGCTTTGTCAATTGTCATCTTGTACACTTGTAT
                      ____________________________________________________________
consensus CACAATCTCTTTTCCCTGTCTGCATCTGGCTTTGTCAATTGTCATCTTGTACACTTGTAT
 
. : . : . : . : . : . :
rJMFF030D07+ GCCTCATGACCCCAAGGAATTGTGATGATACATTCTCCCCCAGATATTTACTTCCTTACA
                      ____________________________________________________________
consensus GCCTCATGACCCCAAGGAATTGTGATGATACATTCTCCCCCAGATATTTACTTCCTTACA