Previous Contig 009621:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030B20Sequence436004927 (6)620009621 (5)gb:AY062465_15651217e-12Arabidopsis thaliana Unknown protein (At3g10980; F9F8.20) mRNA, complete cds.>gb
JMSF007N03Sequence336004927 (6)731009621 (5)gb:AY062465_15651213e-35Arabidopsis thaliana Unknown protein (At3g10980; F9F8.20) mRNA, complete cds.>gb
JMSF012P24Sequence266004927 (6)742009621 (5)gb:AY062465_15651211e-37Arabidopsis thaliana Unknown protein (At3g10980; F9F8.20) mRNA, complete cds.>gb
JMSF013I23Sequence367004927 (6)gb:AY062465_15651213e-24Arabidopsis thaliana Unknown protein (At3g10980; F9F8.20) mRNA, complete cds.>gb733009621 (5)gb:AY062465_15651213e-35Arabidopsis thaliana Unknown protein (At3g10980; F9F8.20) mRNA, complete cds.>gb
JMSF048F09Sequence690004927 (6)gb:AY062465_15651211e-13Arabidopsis thaliana Unknown protein (At3g10980; F9F8.20) mRNA, complete cds.>gb751009621 (5)gb:AY062465_15651215e-39Arabidopsis thaliana Unknown protein (At3g10980; F9F8.20) mRNA, complete cds.>gb

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012P24+ TCGGTTTACTATACGGTGGCNTTTGGAGGATTCAAATG
rJMSF013I23+ GGCTTTTGGAGGATTCAAATG
rJMSF048F09+ CGCCTTCGGTTTACTATACGGTGGCTTTTGGAGGATTCAAATG
rJMSF007N03+ TTTGGAGGATTCAAATG
                      ____________________________________________________________
consensus CGCCTTCGGTTTACTATACGGTGGCTTTTGGAGGATTCAAATG
 
. : . : . : . : . : . :
rJMSF012P24+ AGAAAACGGTACAATTTGCCTTCGTATAATTCGTGTTGTGGTAAATCATCTGTTGCCGAT
rJMSF013I23+ AGAAAACGGTACAATTTGCCTTCGTATAATTCGTGTTGTGGTAAATCATCTGTTGCCGAT
rJMSF048F09+ AGAAAACGGTACAATTTGCCTTCGTATAATTCGTGTTGTGGTAAATCATCTGTTGCCGAT
rJMSF007N03+ AGAAAACGGTACAATTTGCCTTCGTATAATTCGTGTTGTGGTAAATCATCTGTTGCCGAT
                      ____________________________________________________________
consensus AGAAAACGGTACAATTTGCCTTCGTATAATTCGTGTTGTGGTAAATCATCTGTTGCCGAT
 
. : . : . : . : . : . :
rJMSF012P24+ TGTGCACTATGGCTATTCTGTTGCTGGTGCTCTCTCGCCCAGGAAGTGAGGACGGGAAAC
rJMSF013I23+ TGTGCACTATGGCTATTCTGTTGCTGGTGCTCTCTCGCCCAGGAAGTGAGGACGGGAAAC
rJMSF048F09+ TGTGCACTATGGCTATTCTGTTGCTGGTGCTCTCTCGCCCAGGAAGTGAGGACGGGAAAC
rJMSF007N03+ TGTGCACTATGGCTATTCTGTTGCTGGTGCTCTCTCGCCCAGGAAGTGAGGACGGGAAAC
rJMFF030B20+ CCAGGAAGTGAGGACGGGAAAC
                      ____________________________________________________________
consensus TGTGCACTATGGCTATTCTGTTGCTGGTGCTCTCTCGCCCAGGAAGTGAGGACGGGAAAC
 
. : . : . : . : . : . :
rJMSF012P24+ TCATACGACATCGTGGAGGATAAGTTCTACAGGAAACGACACGATAATGGCGAACAGCCT
rJMSF013I23+ TCATACGACATCGTGGAGGATAAGTTCTACAGGAAACGACACGATAATGGCGAACAGCCT
rJMSF048F09+ TCATACGACATCGTGGAGGATAAGTTCTACAGGAAACGACACGATAATGGCGAACAGCCT
rJMSF007N03+ TCATACGACATCGTGGAGGATAAGTTCTACAGGAAACGACACGATAATGGCGAACAGCCT
rJMFF030B20+ TCATACGACATCGTGGAGGATAAGTTNTACAGGAAACGACACGATAATGGCGAACAGCCT
                      ____________________________________________________________
consensus TCATACGACATCGTGGAGGATAAGTTCTACAGGAAACGACACGATAATGGCGAACAGCCT
 
. : . : . : . : . : . :
rJMSF012P24+ CCTCCCGTTTCGCCTTTGCCCCGAGAAGATGGTGTCTTTAGGTCAAGTCCCGACCAAAAA
rJMSF013I23+ CCTCCCGTTTCGCCTTTGCCCCGAGAAGATGGTGTCTTTAGGTCAAGTCCCGACCAAAAA
rJMSF048F09+ CCTCCCGTTTCGCCTTTGCCCCGAGAAGATGGTGTCTTTAGGTCAAGTCCCGACCAAAAA
rJMSF007N03+ CCTCCCGTTTCGCCTTTGCCCCGAGAAGATGGTGTCTTTAGGTCAAGTCCCGACCAAAAA
rJMFF030B20+ CCTCCCGTTTCGCCTTTGCCCCGAGAAGATGGTGTCTTTAGGTCAAGTCCCGACCAAAAA
                      ____________________________________________________________
consensus CCTCCCGTTTCGCCTTTGCCCCGAGAAGATGGTGTCTTTAGGTCAAGTCCCGACCAAAAA
 
. : . : . : . : . : . :
rJMSF012P24+ CCGAAAAGTACCACACCAAGCCCGAGCAGATTTGCAATGGAACATTGCAGTCCAGGTAAC
rJMSF013I23+ CCGAAAAGTACCACACCAAGCCCGAGCAGATTTGCAATGGAACATTGCAGTCCAGGTAAC
rJMSF048F09+ CCGAAAAGTACCACACCAAGCCCGAGCAGATTTGCAATGGAACATTGCAGTCCAGGTAAC
rJMSF007N03+ CCGAAAAGTACCACACCAAGCCCGAGCAGATTTGCAATGGAACATTGCAGTCCAGGTAAC
rJMFF030B20+ CCGAAAAGTACCACACCAAGCCCGAGCAGATTTGCAATGGAACATTGCAGTCCAGGTAAC
                      ____________________________________________________________
consensus CCGAAAAGTACCACACCAAGCCCGAGCAGATTTGCAATGGAACATTGCAGTCCAGGTAAC
 
. : . : . : . : . : . :
rJMSF012P24+ AATGAACCTAATTCGGGAGGTAGCCATGATCCTATGGCGCCTCCTTCTCCCCCGATTATA
rJMSF013I23+ AATGAACCTAATTCGGGAGGTAGCCATGATCCTATGGCGCCTCCTTCTCCCCCGATTATA
rJMSF048F09+ AATGAACCTAATTCGGGAGGTAGCCATGATCCTATGGCGCCTCCTTCTCCCCCGATTATA
rJMSF007N03+ AATGAACCTAATTCGGGAGGTAGCCATGATCCTATGGCGCCTCCTTCTCCCCCGATTATA
rJMFF030B20+ AATGAACCTAATTCGGGAGGTAGCCATGATCCTATGGCGCCTCCTTCTCCCCCGATTATA
                      ____________________________________________________________
consensus AATGAACCTAATTCGGGAGGTAGCCATGATCCTATGGCGCCTCCTTCTCCCCCGATTATA
 
. : . : . : . : . : . :
rJMSF012P24+ CAACGAGAAGATGTTTGACACAACGAAATTTTGAGGTTCCGTTTGAAGTTTGGATTACAA
rJMSF013I23+ CAACGAGAAGATGTTTGACACAACGAAATTTTGAGGTTCCGTTTGAAGTTTGGATTACAA
rJMSF048F09+ CAACGAGAAGATGTTTGACACAACGAAATTTTGAGGTTCCGTTTGAAGTTTGGATTACAA
rJMSF007N03+ CAACGAGAAGATGTTTGACACAACGAAATTTTGAGGTTCCGTTTGAAGTTTGGATTACAA
rJMFF030B20+ CAACGAGAAGATGTTTGACACAACGAAATTTTGAGGTTCCGTTTGAAGTTTGGATTACAA
                      ____________________________________________________________
consensus CAACGAGAAGATGTTTGACACAACGAAATTTTGAGGTTCCGTTTGAAGTTTGGATTACAA
 
. : . : . : . : . : . :
rJMSF012P24+ CTTACGAGTTACGAGAGATTCTTGTGTAGACCACATTTGTTGTCCATTGGAATCTTGTAT
rJMSF013I23+ CTTACGAGTTACGAGAGATTCTTGTGTAGACCACATTTGTTGTCCATTGGAATCTTGTAT
rJMSF048F09+ CTTACGAGTTACGAGAGATTCTTGTGTAGACCACATTTGTTGTCCATTGGAATCTTGTAT
rJMSF007N03+ CTTACGAGTTACGAGAGATTCTTGTGTAGACCACATTTGTTGTCCATTGGAATCTTGTAT
rJMFF030B20+ CTTACGAGTTACGAGAGATTCTTGTGTAGACCACATTTGTTGTCCATTGGAATCTTGTAT
                      ____________________________________________________________
consensus CTTACGAGTTACGAGAGATTCTTGTGTAGACCACATTTGTTGTCCATTGGAATCTTGTAT
 
. : . : . : . : . : . :
rJMSF012P24+ ACATGCAAGATTGCAATGAAGCTGCAGAGATGGGGTTCAACTCGGGATTTTTCTTGGATT
rJMSF013I23+ ACATGCAAGATTGCAATGAAGCTGCAGAGATGGGGTTCAACTCGGGATTTTTCTTGGATT
rJMSF048F09+ ACATGCAAGATTGCAATGAAGCTGCAGAGATGGGGTTCAACTCGGGATTTTTCTTGGATT
rJMSF007N03+ ACATGCAAGATTGCAATGAAGCTGCAGAGATGGGGTTCAACTCGGGATTTTTCTTGGATT
rJMFF030B20+ ACATGCAAGATTGCAATGAAGCTGCAGAGATGGGGTTCAACTCGGGATTTTTCTTGGATT
                      ____________________________________________________________
consensus ACATGCAAGATTGCAATGAAGCTGCAGAGATGGGGTTCAACTCGGGATTTTTCTTGGATT
 
. : . : . : . : . : . :
rJMSF012P24+ ACGAGATGTATAGTAGCCTCGGTTTTCATGCTTCTCATGTTATGTACTTATGTTGTTGTT
rJMSF013I23+ ACGAGATGTATAGTAGCCTCGGTTTTCATGCTTCTCATGTTATGTACTTATGTTGTTGTT
rJMSF048F09+ ACGAGATGTATAGTAGCCTCGGTTTTCATGCTTCTCATGTTATGTACTTATGTTGTTGTT
rJMSF007N03+ ACGAGATGTATAGTAGCCTCGGTTTTCATGCTTCTCATGTTATGTACTTATGTTGTTGTT
rJMFF030B20+ ACGAGATGTATAGTAGCCTCGGTTTTCATGCTTCTCATGTTATGTACTTATGTTGTTGTT
                      ____________________________________________________________
consensus ACGAGATGTATAGTAGCCTCGGTTTTCATGCTTCTCATGTTATGTACTTATGTTGTTGTT
 
. : . : . : . : . : . :
rJMSF012P24+ CTATTGTTTTTGTCTGCATTTTTTTTTGTTTGTTTTCCATATATAAATGCTGCTCCTGAA
rJMSF013I23+ CTATTGTTTTTGTCTGCATTTTTTTTTGTTTGTTTTCCATATATAAATGCTGCTCCTGAA
rJMSF048F09+ CTATTGTTTTTGTCTGCATTTTTTTTTGTTTGTTTTCCATATATAAATGCTGCTCCTGAA
rJMSF007N03+ CTATTGTTTTTGTCTGCATTTTTTTTTGTTTGTTTTCCATATATAAATGCTGCTCCTGAA
rJMFF030B20+ CTATTGTTTTTGTCTGCATTTTTTTTTGTTTGTTTTCCATATATAAATGCTGCTCCTGAA
                      ____________________________________________________________
consensus CTATTGTTTTTGTCTGCATTTTTTTTTGTTTGTTTTCCATATATAAATGCTGCTCCTGAA
 
. : . : . : . : . : . :
rJMSF012P24+ ACTAGATTGTGTAAATGCAA-CAGAAGTTAGAA-CTCCAGAAGAGA
rJMSF013I23+ ACTAGATTGTGTAAATGCAACCAGAAGTTAGAACCTCCAGAAGAGATT
rJMSF048F09+ ACTAGATTGTGTAAATGCAA-CAGAAGTTAGAA-CTCCAGAAGAGATT
rJMSF007N03+ ACTAGATTGTGTAAATGCAA-CAGAAGTTAGAA-CTCCAGAAGAGATT
rJMFF030B20+ ACTAGATTGTGTAAATGCAA-CAGAAGTTAGAA-CTCCAGAAGAGATTGAGTGGGAGAAA
                      ____________________________________________________________
consensus ACTAGATTGTGTAAATGCAA-CAGAAGTTAGAA-CTCCAGAAGAGATTGAGTGGGAGAAA